Transcript: Human NM_001324255.2

Homo sapiens microtubule associated protein 1B (MAP1B), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAP1B (4131)
Length:
11568
CDS:
214..7242

Additional Resources:

NCBI RefSeq record:
NM_001324255.2
NBCI Gene record:
MAP1B (4131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116620 CCCTGACTTAGGAGTTGTATT pLKO.1 888 CDS 100% 13.200 10.560 N MAP1B n/a
2 TRCN0000290688 CCCTGACTTAGGAGTTGTATT pLKO_005 888 CDS 100% 13.200 10.560 N MAP1B n/a
3 TRCN0000116619 GCTTGAAAGAATCCTCGGATA pLKO.1 6662 CDS 100% 4.050 3.240 N MAP1B n/a
4 TRCN0000307239 GCTTGAAAGAATCCTCGGATA pLKO_005 6662 CDS 100% 4.050 3.240 N MAP1B n/a
5 TRCN0000116618 CCCAGAGATATGTCCTTATAT pLKO.1 5101 CDS 100% 15.000 10.500 N MAP1B n/a
6 TRCN0000290689 CCCAGAGATATGTCCTTATAT pLKO_005 5101 CDS 100% 15.000 10.500 N MAP1B n/a
7 TRCN0000370601 GGTGATGCAAGTCACTAAATT pLKO_005 7379 3UTR 100% 15.000 10.500 N MAP1B n/a
8 TRCN0000116617 CCCAATTAACTGAAGCAAATA pLKO.1 8124 3UTR 100% 13.200 9.240 N MAP1B n/a
9 TRCN0000116621 GCCTGGAATAAACAGCATGTT pLKO.1 786 CDS 100% 4.950 3.465 N MAP1B n/a
10 TRCN0000307232 GCCTGGAATAAACAGCATGTT pLKO_005 786 CDS 100% 4.950 3.465 N MAP1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324255.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.