Transcript: Human NM_001324308.2

Homo sapiens neuromedin B receptor (NMBR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
NMBR (4829)
Length:
1994
CDS:
102..830

Additional Resources:

NCBI RefSeq record:
NM_001324308.2
NBCI Gene record:
NMBR (4829)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357652 TATCGGTCTTTCAACTATAAT pLKO_005 519 CDS 100% 15.000 21.000 N NMBR n/a
2 TRCN0000009194 CGCATCAGTAGCTTGGATAAT pLKO.1 213 CDS 100% 13.200 18.480 N NMBR n/a
3 TRCN0000009196 GCTCTTTACCTACTCAGTGAA pLKO.1 624 CDS 100% 4.950 6.930 N NMBR n/a
4 TRCN0000357584 CCTCATACCACTTGCTATTAT pLKO_005 320 CDS 100% 15.000 10.500 N NMBR n/a
5 TRCN0000357653 TCATATTGCAAAGACCTTAAT pLKO_005 356 CDS 100% 13.200 9.240 N NMBR n/a
6 TRCN0000009193 CCTGGAGAATACAATGAACAT pLKO.1 396 CDS 100% 4.950 3.465 N NMBR n/a
7 TRCN0000009192 CCACTTGCTATTATTAGCATT pLKO.1 327 CDS 100% 0.495 0.347 N NMBR n/a
8 TRCN0000009195 CCTTTACATGTATCGGTCTTT pLKO.1 509 CDS 100% 4.950 2.970 N NMBR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487759 TCAAAGTAATATCTTCCCCTCGTC pLX_317 21.9% 61.8% 61.6% V5 (many diffs) n/a
Download CSV