Transcript: Human NM_001324309.2

Homo sapiens kelch like family member 21 (KLHL21), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KLHL21 (9903)
Length:
4939
CDS:
53..1555

Additional Resources:

NCBI RefSeq record:
NM_001324309.2
NBCI Gene record:
KLHL21 (9903)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001324309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144015 CTAAACGGACTCATGTACTTT pLKO.1 1454 CDS 100% 5.625 7.875 N KLHL21 n/a
2 TRCN0000140570 GACAAGATCCCGTCCATGAAT pLKO.1 1529 CDS 100% 5.625 3.938 N KLHL21 n/a
3 TRCN0000140442 GAGGAACGAATGGGACAAGAT pLKO.1 1516 CDS 100% 4.950 3.465 N KLHL21 n/a
4 TRCN0000143645 CATGTACTTTGTCAGGGATGA pLKO.1 1465 CDS 100% 4.050 2.835 N KLHL21 n/a
5 TRCN0000139939 GAGGTACAACTCAAGCGTGAA pLKO.1 1111 CDS 100% 4.050 2.835 N KLHL21 n/a
6 TRCN0000122628 GCTGGTCACTGTCGACTGCTA pLKO.1 952 CDS 100% 0.880 0.616 N KLHL21 n/a
7 TRCN0000257130 GCAAGGAGACCATGGTGATAC pLKO_005 1347 CDS 100% 10.800 7.560 N Klhl21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324309.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.