Transcript: Mouse NM_001324406.1

Mus musculus RIKEN cDNA 6720489N17 gene (6720489N17Rik), transcript variant 2, mRNA.

Source:
NCBI, updated 2016-05-04
Taxon:
Mus musculus (mouse)
Gene:
6720489N17Rik (211378)
Length:
2756
CDS:
90..581

Additional Resources:

NCBI RefSeq record:
NM_001324406.1
NBCI Gene record:
6720489N17Rik (211378)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001324406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238949 GCATGTACTGGATCGGTTAAA pLKO_005 2280 3UTR 100% 13.200 9.240 N 6720489N17Rik n/a
2 TRCN0000238950 TACAAGGCCCAGTCTTCTTAA pLKO_005 625 3UTR 100% 13.200 9.240 N 6720489N17Rik n/a
3 TRCN0000238951 AGTCGATCAAAGAACACTAAC pLKO_005 562 CDS 100% 10.800 7.560 N 6720489N17Rik n/a
4 TRCN0000238947 GAAATCTTCAGATTCATAGTA pLKO_005 1308 3UTR 100% 5.625 3.938 N 6720489N17Rik n/a
5 TRCN0000238948 TGTAAGGAATGTGATTAAACT pLKO_005 1526 3UTR 100% 5.625 3.375 N 6720489N17Rik n/a
6 TRCN0000218885 CAGAATCCTTCTGAGTATAAG pLKO_005 1819 3UTR 100% 13.200 6.600 Y Zfp808 n/a
7 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 666 3UTR 100% 13.200 6.600 Y Zfp934 n/a
8 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 666 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
9 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 666 3UTR 100% 13.200 6.600 Y EG668616 n/a
10 TRCN0000225752 TGAATATACTCAACGTGATAA pLKO_005 424 CDS 100% 13.200 6.600 Y Zfp808 n/a
11 TRCN0000240176 ACCCTACAAATGTAATCAATG pLKO_005 676 3UTR 100% 10.800 5.400 Y n/a
12 TRCN0000193699 CTGGACAGAAACCCTATGAAT pLKO.1 582 CDS 100% 5.625 2.813 Y Zfp935 n/a
13 TRCN0000174822 GAAGCTCTACAAAGATGTCAT pLKO.1 338 CDS 100% 4.950 2.475 Y Zfp935 n/a
14 TRCN0000096538 GCAGAGAAACCCTCTGAATAT pLKO.1 410 CDS 100% 1.320 0.660 Y Zfp934 n/a
15 TRCN0000175997 GCAGAGAAACCCTCTGAATAT pLKO.1 410 CDS 100% 1.320 0.660 Y Zfp935 n/a
16 TRCN0000096536 GTGCAGAGAAACCCTCTGAAT pLKO.1 408 CDS 100% 0.495 0.248 Y Zfp934 n/a
17 TRCN0000193893 CCTTACACAAGTCTCCAAGTA pLKO.1 545 CDS 100% 4.950 2.475 Y Zfp935 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001324406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.