Transcript: Human NM_001326419.2

Homo sapiens phosphatidylserine decarboxylase (PISD), transcript variant 11, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
PISD (23761)
Length:
2664
CDS:
530..1543

Additional Resources:

NCBI RefSeq record:
NM_001326419.2
NBCI Gene record:
PISD (23761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001326419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414132 CCGTTCCTTCTGCCTACAAAT pLKO_005 1755 3UTR 100% 13.200 18.480 N PISD n/a
2 TRCN0000416538 GAATGATCTCAGTCACATTTG pLKO_005 1791 3UTR 100% 10.800 8.640 N PISD n/a
3 TRCN0000078465 CAAGGGCTCCTACAATGACTT pLKO.1 1348 CDS 100% 4.950 3.960 N PISD n/a
4 TRCN0000078466 GATGGAAGGATCCTCAACTTT pLKO.1 998 CDS 100% 5.625 3.938 N PISD n/a
5 TRCN0000078464 AGCCTGTACATCTGGACGTTT pLKO.1 848 CDS 100% 4.950 3.465 N PISD n/a
6 TRCN0000078463 CCCTACATGAAATATGGGAAA pLKO.1 2339 3UTR 100% 4.050 2.835 N PISD n/a
7 TRCN0000115413 CAGTATGAGAAGTACAGGGAA pLKO.1 251 5UTR 100% 2.640 1.848 N Pisd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001326419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02840 pDONR223 100% 89.8% 89.8% None 739_740ins114 n/a
2 ccsbBroad304_02840 pLX_304 0% 89.8% 89.8% V5 739_740ins114 n/a
3 TRCN0000470351 TCTTGCATCGTGTGAACGACTCAT pLX_317 44.3% 89.8% 89.8% V5 739_740ins114 n/a
Download CSV