Construct: ORF TRCN0000470351
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011522.1_s317c1
- Derived from:
- ccsbBroadEn_02840
- DNA Barcode:
- TCTTGCATCGTGTGAACGACTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PISD (23761)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000470351
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326415.2 | 100% | 100% | |
| 2 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326416.2 | 100% | 100% | |
| 3 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326417.2 | 100% | 100% | |
| 4 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_014338.3 | 100% | 100% | |
| 5 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_178022.2 | 100% | 100% | |
| 6 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326413.2 | 93.7% | 93.2% | (many diffs) |
| 7 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326414.2 | 93.7% | 93.2% | (many diffs) |
| 8 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326419.2 | 89.8% | 89.8% | 739_740ins114 |
| 9 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326418.2 | 84.7% | 76.6% | (many diffs) |
| 10 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326411.1 | 83.7% | 78% | (many diffs) |
| 11 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326412.1 | 82.3% | 76.5% | (many diffs) |
| 12 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326420.2 | 75% | 67.2% | (many diffs) |
| 13 | human | 23761 | PISD | phosphatidylserine decarbox... | NM_001326421.1 | 56.7% | 47.2% | (many diffs) |
| 14 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | NM_001347332.1 | 86.2% | 90.1% | (many diffs) |
| 15 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_006503999.3 | 86.2% | 90.1% | (many diffs) |
| 16 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_006504000.4 | 86.2% | 90.1% | (many diffs) |
| 17 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_030254583.1 | 86.2% | 90.1% | (many diffs) |
| 18 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_030254584.1 | 86.2% | 90.1% | (many diffs) |
| 19 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_030254585.1 | 86.2% | 90.1% | (many diffs) |
| 20 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_017320930.2 | 82.4% | 84.7% | (many diffs) |
| 21 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_006504002.4 | 78.4% | 82.6% | (many diffs) |
| 22 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_030254586.1 | 69.9% | 74.1% | (many diffs) |
| 23 | mouse | 320951 | Pisd | phosphatidylserine decarbox... | XM_030254588.1 | 69.9% | 74.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1191
- ORF length:
- 1125
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gtgtcagtca gaggcgcggc aaggaccaga gctccgcgcg gcgaaatggt 121 tgcacttccc ccagctggcc ctgaggcgga ggctggggca gctgagctgc atgtccagac 181 ccgctctgaa actgcgctcc tggcccttga ccgtcctcta ctacctcctg cccttcggcg 241 ccctcagacc gctcagccgg gtgggatgga ggcccgtaag cagggtggct ttgtacaagt 301 cagtgccaac gcgcttgctg tcacgggcct ggggtcgcct caatcaggtg gagctgccac 361 actggctgcg caggcccgtc tacagcctgt acatctggac gtttggggtg aacatgaaag 421 aggccgctgt ggaggacctg catcactacc gcaacctcag cgagttcttc cggcgcaagc 481 tgaagccgca ggcccggcct gtctgtggcc tgcacagcgt gattagccca tcggatggaa 541 ggatcctcaa ctttgggcag gtgaagaact gtgaggtgga gcaggtaaag ggggtcacct 601 actccctgga gtcgttcctg ggcccgcgta tgtgcacaga ggacctgccc ttcccaccag 661 ccgcgtcgtg tgactccttc aagaaccagc tggTCACCCG GGAAGGGAAT GAGCTCTATC 721 ACTGTGTCAT CTACCTGGCC CCTGGGGACT ACCACTGCTT CCACTCCCCC ACCGACTGGA 781 CTGTGTCCCA CCGGCGCCAC TTCCCAGGCT CCCTGATGTC AGTGAACCCT GGCATGGCTC 841 GCTGGATCAA AGAGCTCTTC TGCCATAACG AGCGGGTGGT CCTGACGGGG GACTGGAAAC 901 ATGGCTTCTT CTCACTGACA GCTGTGGGGG CCACCAACGT GGGCTCCATT CGCATCTACT 961 TTGACCGGGA CCTGCACACA AACAGCCCAA GGCACAGCAA GGGCTCCTAC AATGACTTCA 1021 GCTTCGTGAC GCACACCAAT AGAGAGGGCG TCCCCATGCG TAAGGGCGAG CACCTGGGCG 1081 AGTTCAACCT GGGCTCCACC ATCGTGCTCA TCTTCGAGGC CCCCAAGGAC TTCAATTTCC 1141 AGCTGAAAAC AGGACAGAAA ATCCGCTTTG GGGAAGCCCT GGGCTCGCTC TACCCAACTT 1201 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1261 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1321 CTTGTGGAAA GGACGATCTT GCATCGTGTG AACGACTCAT ACGCGTTAAG TCgacaatca 1381 acctctggat tacaaaattt gtgaaagatt