Transcript: Mouse NM_001328047.1

Mus musculus RAB3A, member RAS oncogene family (Rab3a), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Rab3a (19339)
Length:
1510
CDS:
211..873

Additional Resources:

NCBI RefSeq record:
NM_001328047.1
NBCI Gene record:
Rab3a (19339)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001328047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348695 CGCAACGACAAGAGGATCAAG pLKO_005 406 CDS 100% 4.950 6.930 N Rab3a n/a
2 TRCN0000089149 CGACTATATGTTCAAGATCCT pLKO.1 267 CDS 100% 2.640 3.696 N Rab3a n/a
3 TRCN0000089148 GCCTTATACTTTGGGATAAAT pLKO.1 1237 3UTR 100% 15.000 10.500 N Rab3a n/a
4 TRCN0000089152 CAGCGCCAAGGACAACATTAA pLKO.1 702 CDS 100% 13.200 9.240 N Rab3a n/a
5 TRCN0000351828 CAGCGCCAAGGACAACATTAA pLKO_005 702 CDS 100% 13.200 9.240 N Rab3a n/a
6 TRCN0000348694 ACTGCTGCTCCCTCTCCTTTA pLKO_005 1033 3UTR 100% 10.800 7.560 N Rab3a n/a
7 TRCN0000376968 GACGTGATCTGTGAGAAGATG pLKO_005 751 CDS 100% 4.950 3.465 N Rab3a n/a
8 TRCN0000381759 CAACGACAAGAGGATCAAGCT pLKO_005 408 CDS 100% 2.640 1.848 N RAB3A n/a
9 TRCN0000089150 ACCAATGAGGAGTCATTTAAT pLKO.1 523 CDS 100% 1.500 1.050 N Rab3a n/a
10 TRCN0000089151 TCACCAATGAGGAGTCATTTA pLKO.1 521 CDS 100% 1.320 0.924 N Rab3a n/a
11 TRCN0000351827 TCACCAATGAGGAGTCATTTA pLKO_005 521 CDS 100% 1.320 0.924 N Rab3a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001328047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01358 pDONR223 100% 89.2% 99% None (many diffs) n/a
2 ccsbBroad304_01358 pLX_304 0% 89.2% 99% V5 (many diffs) n/a
3 TRCN0000467081 AATGGGAAATGACATTGAAAATTA pLX_317 57.6% 89.2% 99% V5 (many diffs) n/a
Download CSV