Transcript: Human NM_001329222.1

Homo sapiens glucosidase II alpha subunit (GANAB), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GANAB (23193)
Length:
4105
CDS:
543..3086

Additional Resources:

NCBI RefSeq record:
NM_001329222.1
NBCI Gene record:
GANAB (23193)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049582 CGATACCGTGTACCAGATGTT pLKO.1 585 CDS 100% 4.950 6.930 N GANAB n/a
2 TRCN0000049579 GCGATATTCTTTGCTGCCCTT pLKO.1 2360 CDS 100% 2.160 3.024 N GANAB n/a
3 TRCN0000049581 GCATAACATCTATGGCCTTTA pLKO.1 1964 CDS 100% 10.800 8.640 N GANAB n/a
4 TRCN0000298663 CATTAGTGCTGAGAGATATTC pLKO_005 3125 3UTR 100% 13.200 9.240 N GANAB n/a
5 TRCN0000298665 TGCTGATGGCAAGCGGTATTT pLKO_005 1547 CDS 100% 13.200 9.240 N GANAB n/a
6 TRCN0000049580 GCTGTGGATAGAAGCAACTTT pLKO.1 345 5UTR 100% 5.625 3.938 N GANAB n/a
7 TRCN0000286780 GCTGTGGATAGAAGCAACTTT pLKO_005 345 5UTR 100% 5.625 3.938 N GANAB n/a
8 TRCN0000049578 CCCAACCTCTTTGTCTGGAAT pLKO.1 1854 CDS 100% 4.950 3.465 N GANAB n/a
9 TRCN0000286704 CCCAACCTCTTTGTCTGGAAT pLKO_005 1854 CDS 100% 4.950 3.465 N GANAB n/a
10 TRCN0000293966 GTACCTGCCTGTAACTCTAAG pLKO_005 2624 CDS 100% 0.000 0.000 N GANAB n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 223 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 223 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329222.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11692 pDONR223 100% 99.9% 99.7% None 907C>T;1090C>T n/a
2 ccsbBroad304_11692 pLX_304 0% 99.9% 99.7% V5 907C>T;1090C>T n/a
3 TRCN0000476304 CCCGTTTACTTCCGCCCCATAGCC pLX_317 15.8% 99.9% 99.7% V5 907C>T;1090C>T n/a
Download CSV