Transcript: Mouse NM_001329490.1

Mus musculus neurogenic differentiation 4 (Neurod4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Neurod4 (11923)
Length:
3509
CDS:
242..1234

Additional Resources:

NCBI RefSeq record:
NM_001329490.1
NBCI Gene record:
Neurod4 (11923)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001329490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429618 TTGAATGCTCTGCCAATTAAC pLKO_005 1529 3UTR 100% 13.200 18.480 N Neurod4 n/a
2 TRCN0000075596 GCCTCAACCATTTAAGAGTTT pLKO.1 916 CDS 100% 4.950 6.930 N Neurod4 n/a
3 TRCN0000431707 GTCATGCCATGTTACTCTAAA pLKO_005 578 CDS 100% 13.200 10.560 N Neurod4 n/a
4 TRCN0000417824 TTATACCTCTGCAAGTCTAAG pLKO_005 1084 CDS 100% 10.800 8.640 N Neurod4 n/a
5 TRCN0000424462 CATTGGACCAGTCCTACATTT pLKO_005 1413 3UTR 100% 13.200 9.240 N Neurod4 n/a
6 TRCN0000075597 CTTTCCAAGATAGAGACTCTT pLKO.1 608 CDS 100% 4.950 3.465 N Neurod4 n/a
7 TRCN0000075594 GCATGTGCATTCAACTCCCTT pLKO.1 1111 CDS 100% 2.640 1.848 N Neurod4 n/a
8 TRCN0000075595 GCTCTTATGGAATGCTCGGAA pLKO.1 357 CDS 100% 2.640 1.848 N Neurod4 n/a
9 TRCN0000075593 CCCACCTAACACTGATTGTTA pLKO.1 2345 3UTR 100% 0.563 0.394 N Neurod4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329490.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12411 pDONR223 100% 67.3% 70.3% None (many diffs) n/a
2 ccsbBroad304_12411 pLX_304 0% 67.3% 70.3% V5 (many diffs) n/a
3 TRCN0000476651 GATGCCGCAGTATTATAAACGGGT pLX_317 43.1% 67.3% 70.3% V5 (many diffs) n/a
Download CSV