Transcript: Human NM_001329603.1

Homo sapiens adenylate kinase 9 (AK9), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
AK9 (221264)
Length:
3450
CDS:
754..2235

Additional Resources:

NCBI RefSeq record:
NM_001329603.1
NBCI Gene record:
AK9 (221264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154069 CCTGTCCTAATTCTTGGTGAT pLKO.1 2584 3UTR 100% 4.050 5.670 N AK9 n/a
2 TRCN0000153366 GAAGAGGCATTTATTGCCGAA pLKO.1 1594 CDS 100% 2.160 3.024 N AK9 n/a
3 TRCN0000154027 CCATGACTACCTTACAGCAAA pLKO.1 1340 CDS 100% 4.950 3.465 N AK9 n/a
4 TRCN0000152089 CCTCTCATGTTTCTTCTCAAT pLKO.1 3086 3UTR 100% 4.950 3.465 N AK9 n/a
5 TRCN0000150692 GCATGGAAATGTATTCGTGTT pLKO.1 1126 CDS 100% 4.050 2.835 N AK9 n/a
6 TRCN0000155314 GCTGAAACCGAATCAGGAGTT pLKO.1 1180 CDS 100% 4.050 2.835 N AK9 n/a
7 TRCN0000153728 CAGAAGTCTGTCACTTTGGTT pLKO.1 1283 CDS 100% 3.000 2.100 N AK9 n/a
8 TRCN0000155058 GCACCAAGATACAGATGGCAA pLKO.1 1942 CDS 100% 2.640 1.848 N AK9 n/a
9 TRCN0000154538 GCCAGAGAATTTCTGGGCAAA pLKO.1 1433 CDS 100% 0.405 0.284 N AK9 n/a
10 TRCN0000153994 CCAGGTCAAATCTGGAATGTT pLKO.1 3049 3UTR 100% 5.625 3.375 N AK9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329603.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09870 pDONR223 100% 85.3% 85.3% None 1_216del;897T>C n/a
2 ccsbBroad304_09870 pLX_304 0% 85.3% 85.3% V5 1_216del;897T>C n/a
3 TRCN0000473607 GACAAGATCGTGTAAAGATTAAGA pLX_317 38.5% 85.3% 85.3% V5 1_216del;897T>C n/a
Download CSV