Transcript: Human NM_001329684.1

Homo sapiens O-acyl-ADP-ribose deacylase 1 (OARD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-25
Taxon:
Homo sapiens (human)
Gene:
OARD1 (221443)
Length:
1427
CDS:
422..880

Additional Resources:

NCBI RefSeq record:
NM_001329684.1
NBCI Gene record:
OARD1 (221443)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439649 GACCGGGCAAACCTACCTTAA pLKO_005 939 3UTR 100% 10.800 15.120 N OARD1 n/a
2 TRCN0000414189 AGGATTGGATGTGGTCTTGAT pLKO_005 776 CDS 100% 4.950 6.435 N OARD1 n/a
3 TRCN0000414259 CTGAAGAGAGATGGGCGATAT pLKO_005 632 CDS 100% 10.800 8.640 N OARD1 n/a
4 TRCN0000128685 CATTCCAGTTAGTTTGGCATT pLKO.1 1251 3UTR 100% 4.050 3.240 N OARD1 n/a
5 TRCN0000217524 GAAGAGAGATGGGCGATATAT pLKO.1 634 CDS 100% 15.000 10.500 N Oard1 n/a
6 TRCN0000428045 ACTCTGAACCAGTGAACATTT pLKO_005 874 CDS 100% 13.200 9.240 N OARD1 n/a
7 TRCN0000129418 GCGATGATCGAGGAGGTATTT pLKO.1 821 CDS 100% 13.200 9.240 N OARD1 n/a
8 TRCN0000250272 TGAAGAGAGATGGGCGATATA pLKO_005 633 CDS 100% 13.200 9.240 N Oard1 n/a
9 TRCN0000130281 CGCACAAGCCAACTTATGAAA pLKO.1 684 CDS 100% 5.625 3.938 N OARD1 n/a
10 TRCN0000436540 GGAAGCAGAATCACTTATGTG pLKO_005 452 CDS 100% 4.950 3.465 N OARD1 n/a
11 TRCN0000129341 CTTGATCGTCTGCAATGGGAA pLKO.1 791 CDS 100% 2.640 1.848 N OARD1 n/a
12 TRCN0000128282 GAAGAGTTTAGAGGCAATGAA pLKO.1 712 CDS 100% 5.625 3.375 N OARD1 n/a
13 TRCN0000429881 CTTATGTGAAAGGAGACCTTT pLKO_005 465 CDS 100% 4.950 2.970 N OARD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329684.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05258 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05258 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467916 GTTTTAGAGTGACGTATAGCATAC pLX_317 95.3% 100% 100% V5 n/a
4 ccsbBroadEn_09872 pDONR223 100% 99.5% 98.6% None 9C>A;11G>C n/a
5 ccsbBroad304_09872 pLX_304 0% 99.5% 98.6% V5 9C>A;11G>C n/a
6 TRCN0000477840 TAGCGAACTCCGCCAAACTGCGCA pLX_317 65.1% 99.5% 98.6% V5 9C>A;11G>C n/a
Download CSV