Transcript: Human NM_001329718.2

Homo sapiens family with sequence similarity 163 member A (FAM163A), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
FAM163A (148753)
Length:
2965
CDS:
453..956

Additional Resources:

NCBI RefSeq record:
NM_001329718.2
NBCI Gene record:
FAM163A (148753)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139422 CCTGGCGATGAGCCATTTATT pLKO.1 2302 3UTR 100% 15.000 10.500 N FAM163A n/a
2 TRCN0000140563 GTGATCCTCCTCTGCATCATT pLKO.1 498 CDS 100% 5.625 3.938 N FAM163A n/a
3 TRCN0000139170 CCCATGTACCAGAGAAGGAAA pLKO.1 1979 3UTR 100% 4.950 3.465 N FAM163A n/a
4 TRCN0000144354 CGAAATCCTTTCTCTGACTTA pLKO.1 1677 3UTR 100% 4.950 3.465 N FAM163A n/a
5 TRCN0000144809 GCTGAAATCTTGATTCTGCAT pLKO.1 2520 3UTR 100% 2.640 1.848 N FAM163A n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1883 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329718.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05018 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05018 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475177 GTCCGCCCCTCGCGGCGCAATAAG pLX_317 74% 100% 100% V5 n/a
Download CSV