Transcript: Human NM_001329748.1

Homo sapiens N-terminal EF-hand calcium binding protein 2 (NECAB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
NECAB2 (54550)
Length:
1552
CDS:
18..1124

Additional Resources:

NCBI RefSeq record:
NM_001329748.1
NBCI Gene record:
NECAB2 (54550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445364 GAAGGAGACGGCCAATCAGAT pLKO_005 527 CDS 100% 4.950 6.930 N NECAB2 n/a
2 TRCN0000056237 GCTGTGTGATTACTTTGTGGA pLKO.1 371 CDS 100% 2.640 3.696 N NECAB2 n/a
3 TRCN0000056235 CTCCGACAGAACCACATCAAA pLKO.1 609 CDS 100% 5.625 4.500 N NECAB2 n/a
4 TRCN0000056233 GAGGATCTCTTTCACACGATT pLKO.1 315 CDS 100% 4.950 3.960 N NECAB2 n/a
5 TRCN0000056234 CCCGAGCAACTGAGCGAGTTT pLKO.1 849 CDS 100% 1.650 1.320 N NECAB2 n/a
6 TRCN0000421415 AGGTGTTTCCCTGTTGTTAAG pLKO_005 1245 3UTR 100% 10.800 7.560 N NECAB2 n/a
7 TRCN0000437798 AGCAACGTGGACCAGTTTGTG pLKO_005 492 CDS 100% 4.950 3.465 N NECAB2 n/a
8 TRCN0000417023 TCTTTGCAGATGGCGTCCTTA pLKO_005 280 CDS 100% 4.950 3.465 N NECAB2 n/a
9 TRCN0000056236 CACCTTTGTCATCTATGAGTT pLKO.1 956 CDS 100% 4.950 2.970 N NECAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329748.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12058 pDONR223 100% 57.2% 57.2% None 1_441del;795_796ins54 n/a
2 ccsbBroad304_12058 pLX_304 0% 57.2% 57.2% V5 1_441del;795_796ins54 n/a
3 TRCN0000472296 ACAAACCAGCGGTAGAGCCCTGTC pLX_317 65.9% 57.2% 57.2% V5 1_441del;795_796ins54 n/a
Download CSV