Transcript: Human NM_001329754.2

Homo sapiens bone morphogenetic protein 5 (BMP5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
BMP5 (653)
Length:
3859
CDS:
726..1979

Additional Resources:

NCBI RefSeq record:
NM_001329754.2
NBCI Gene record:
BMP5 (653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371430 TGGACGCAGTATCAACGTAAA pLKO_005 1556 CDS 100% 10.800 15.120 N BMP5 n/a
2 TRCN0000058268 CCAGCAATCATTGGGTGATTA pLKO.1 1489 CDS 100% 1.320 1.848 N BMP5 n/a
3 TRCN0000058272 GCACCTCTCTTTATGCTGGAT pLKO.1 954 CDS 100% 2.640 2.112 N BMP5 n/a
4 TRCN0000058269 CGGAGCAACAACCGATTTGAA pLKO.1 1335 CDS 100% 5.625 3.938 N BMP5 n/a
5 TRCN0000058271 GACGGGAAATACAAAGGGAAA pLKO.1 868 CDS 100% 4.050 2.835 N BMP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00166 pDONR223 100% 91.8% 91.8% None 1103_1104ins111 n/a
2 ccsbBroad304_00166 pLX_304 0% 91.8% 91.8% V5 1103_1104ins111 n/a
3 TRCN0000472902 ATCCAAGTAAGTCGTATTTTTTTA pLX_317 33.5% 91.8% 91.8% V5 1103_1104ins111 n/a
Download CSV