Transcript: Human NM_001330126.1

Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain (CRADD), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CRADD (8738)
Length:
756
CDS:
7..399

Additional Resources:

NCBI RefSeq record:
NM_001330126.1
NBCI Gene record:
CRADD (8738)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303967 ACAATGCTCCTGCTGGATATC pLKO_005 166 CDS 100% 10.800 7.560 N CRADD n/a
2 TRCN0000303969 TAGATTCCCTACAGGAGTTTC pLKO_005 224 CDS 100% 10.800 7.560 N CRADD n/a
3 TRCN0000107206 CCCTAAAGCATTTGATACATT pLKO.1 201 CDS 100% 5.625 3.938 N CRADD n/a
4 TRCN0000107209 GTACCTCTACCAGGAAGGAAT pLKO.1 90 CDS 100% 0.000 0.000 N CRADD n/a
5 TRCN0000119881 GACTGGTTCTTCAGTACCTTT pLKO.1 77 CDS 100% 4.950 3.465 N Cradd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330126.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15642 pDONR223 0% 61% 51.2% None (many diffs) n/a
2 ccsbBroad304_15642 pLX_304 0% 61% 51.2% V5 (many diffs) n/a
3 TRCN0000473154 GGAGGCGATCCTGAATTCCGGTTC pLX_317 68.5% 61% 51.2% V5 (many diffs) n/a
Download CSV