Transcript: Human NM_001330179.1

Homo sapiens mitochondrial transcription termination factor 4 (MTERF4), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
MTERF4 (130916)
Length:
1154
CDS:
125..706

Additional Resources:

NCBI RefSeq record:
NM_001330179.1
NBCI Gene record:
MTERF4 (130916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438960 ATGCGCCAGCAGGACATTAAC pLKO_005 125 CDS 100% 13.200 18.480 N MTERF4 n/a
2 TRCN0000420922 GATTAAGCAGAGACACATTTA pLKO_005 340 CDS 100% 13.200 9.240 N MTERF4 n/a
3 TRCN0000167068 CCATCCTGAATAAGATACTTA pLKO.1 938 3UTR 100% 5.625 3.938 N MTERF4 n/a
4 TRCN0000172359 CCTGGGTCAACTGGAATACAA pLKO.1 238 CDS 100% 5.625 3.938 N MTERF4 n/a
5 TRCN0000167014 GAAATTAAAGAGGGTGCTTTA pLKO.1 82 5UTR 100% 1.080 0.756 N MTERF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15243 pDONR223 95.3% 50.4% 50.3% None 0_1ins564;282G>A;355T>C n/a
2 ccsbBroad304_15243 pLX_304 0% 50.4% 50.3% V5 0_1ins564;282G>A;355T>C n/a
3 TRCN0000481459 GGGCGTGAGATAAAAGTGTAAAAT pLX_317 38.4% 47.1% 46.9% V5 (many diffs) n/a
Download CSV