Construct: ORF TRCN0000481459
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000320.1_s317c1
- Derived from:
- ccsbBroadEn_15243
- DNA Barcode:
- GGGCGTGAGATAAAAGTGTAAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MTERF4 (130916)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000481459
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 130916 | MTERF4 | mitochondrial transcription... | NM_182501.4 | 96.5% | 96.3% | (many diffs) |
| 2 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003387.2 | 96.5% | 96.3% | (many diffs) |
| 3 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003379.2 | 85.7% | 85.5% | (many diffs) |
| 4 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003380.2 | 85.7% | 85.5% | (many diffs) |
| 5 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003381.2 | 85.7% | 85.5% | (many diffs) |
| 6 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003382.2 | 85.7% | 85.5% | (many diffs) |
| 7 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003383.2 | 85.7% | 85.5% | (many diffs) |
| 8 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_024452707.1 | 64.1% | 44.6% | (many diffs) |
| 9 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_006712292.4 | 62.4% | 43.6% | (many diffs) |
| 10 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_024452708.1 | 62.3% | 44.9% | (many diffs) |
| 11 | human | 130916 | MTERF4 | mitochondrial transcription... | NM_001330180.1 | 60.6% | 49.2% | (many diffs) |
| 12 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_024452706.1 | 56.4% | 56.3% | 519_662del;850G>T;852_852delCins400 |
| 13 | human | 130916 | MTERF4 | mitochondrial transcription... | NM_001330179.1 | 47.1% | 46.9% | (many diffs) |
| 14 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_017003391.2 | 47.1% | 46.9% | (many diffs) |
| 15 | human | 130916 | MTERF4 | mitochondrial transcription... | XM_024452709.1 | 47.1% | 46.9% | (many diffs) |
| 16 | human | 130916 | MTERF4 | mitochondrial transcription... | NR_138464.1 | 29.5% | (many diffs) | |
| 17 | human | 130916 | MTERF4 | mitochondrial transcription... | NR_028049.1 | 24.1% | (many diffs) | |
| 18 | human | 130916 | MTERF4 | mitochondrial transcription... | NR_138465.1 | 23.9% | (many diffs) | |
| 19 | human | 130916 | MTERF4 | mitochondrial transcription... | NR_138466.1 | 21.6% | (many diffs) | |
| 20 | human | 130916 | MTERF4 | mitochondrial transcription... | NR_138463.2 | 16.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1176
- ORF length:
- 1107
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggctgcgttc ggccgtcagg tccttgattg gcaccgcctg atccccctca 121 cctgggcctg tatggctagg cagactcctc atcttggaga acagagaagg acgacagctt 181 ctttgttgcg caaactgact acagcctcca atggaggggt cattgaggag ttatcttgtg 241 ttagatccaa taactatgtg caggaaccag agtgcaggag gaatcttgtt cagtgcctcc 301 ttgagaagca ggggactcct gtggtacaag ggtccttgga gctagagagg gtcatgagtt 361 ccctcctgga catgggtttc agcaatgccc atattaatga attgctcagt gtacggcgag 421 gtgccagtct tcaacagttg ctggacatca tttcagaatt tattctcttg ggtctgaatc 481 cagagcctgt gtgtgtggtc ttgaagaaaa gtccccagtt attgaaactg cctattatgc 541 aaatgaggaa gcgctccagt tacctgcaaa agcttgggct tggagaaggg aaattaaaga 601 gggtgcttta ctgttgccct gaaattttca ccatgcgcca gcaggacatt aacgacactg 661 tcaggcttct caaggagaag tgccttttca cggtacagca agtcaccaag attttgcaca 721 gttgcccctc tgttcttcga gaggacctgg gTCAACTGGA ATACAAGTTT CAGTATGCAT 781 ACTTCAGGAT GGGAATTAAG CATCCAGACA TTGTAAAGAG TGAGTACTTG CAGTATTCAC 841 TAACCAAGAT TAAGCAGAGA CACATTTACC TGGAGCGCCT GGGACGGTAC CAAACCCCTG 901 ATAAGAAGGG GCAAACACAG ATCCCTAACC CATTGCTCAA GGACATTCTC AGAGTTTCAG 961 AAGCTGAGTT TTTGGCCAGG ACAGCCCGTA CTTCTGTTGA GGAGTTTCAA GTTTTTAAGA 1021 AGCTCCTGGC TCGGGAGGAG GAGGAGTCTG AGAGCAGCAC ATCTGATGAC AAAAGGGCAA 1081 GTCTGGATGA GGATGAGGAT GACGATGATG AGGAGGACAA TGATGAGGAT GACAATGATG 1141 AGGATGACGA TGATGAGGAC GACGACGAGG AGGAATTGCC AACTTTCTTG TACAAAGTGG 1201 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1261 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1321 AGGGCGTGAG ATAAAAGTGT AAAATACGCG TTAAGTCgac aatcaacctc tggattacaa 1381 aatttgtgaa agatt