Transcript: Human NM_001330219.3

Homo sapiens hydroxysteroid 17-beta dehydrogenase 1 (HSD17B1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
HSD17B1 (3292)
Length:
1277
CDS:
12..1001

Additional Resources:

NCBI RefSeq record:
NM_001330219.3
NBCI Gene record:
HSD17B1 (3292)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415728 AGTTCGCGCTCGAAGGCTTAT pLKO_005 490 CDS 100% 10.800 15.120 N HSD17B1 n/a
2 TRCN0000415412 ATAGATCGCGTTAGCCAGTTT pLKO_005 1103 3UTR 100% 4.950 6.930 N HSD17B1 n/a
3 TRCN0000028075 CGGGAAGTGTTCGGCGACGTT pLKO.1 858 CDS 100% 0.000 0.000 N HSD17B1 n/a
4 TRCN0000415579 ATCCATCCCAGAGCTTCAAAG pLKO_005 88 CDS 100% 10.800 7.560 N HSD17B1 n/a
5 TRCN0000028054 GCTGCCTTTCAATGACGTTTA pLKO.1 458 CDS 100% 10.800 7.560 N HSD17B1 n/a
6 TRCN0000414298 GTGAATGTAGTAGGGACTGTG pLKO_005 351 CDS 100% 4.050 2.835 N HSD17B1 n/a
7 TRCN0000028107 CCACACCTTCCACCGCTTCTA pLKO.1 644 CDS 100% 1.650 1.155 N HSD17B1 n/a
8 TRCN0000028086 GCCACGTTGAGGGACCTGAAA pLKO.1 114 CDS 100% 1.650 1.155 N HSD17B1 n/a
9 TRCN0000028035 GCTGGACGTAAGGGACTCAAA pLKO.1 203 CDS 100% 4.950 2.970 N HSD17B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06404 pDONR223 100% 99.5% 99.3% None 540_542delCAG;940G>A n/a
2 ccsbBroad304_06404 pLX_304 0% 99.5% 99.3% V5 540_542delCAG;940G>A n/a
3 TRCN0000477430 TTGCTCCGTCCTTAGTTATGGAAG pLX_317 29.1% 99.5% 99.3% V5 540_542delCAG;940G>A n/a
Download CSV