Transcript: Human NM_001330220.2

Homo sapiens dickkopf WNT signaling pathway inhibitor 3 (DKK3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
DKK3 (27122)
Length:
2771
CDS:
192..1286

Additional Resources:

NCBI RefSeq record:
NM_001330220.2
NBCI Gene record:
DKK3 (27122)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033398 GACACGAAGGTTGGAAATAAT pLKO.1 492 CDS 100% 15.000 10.500 N DKK3 n/a
2 TRCN0000033396 CCCAGCATGTACTGCCAGTTT pLKO.1 654 CDS 100% 4.950 3.465 N DKK3 n/a
3 TRCN0000033395 GCAAACTTACCTCCCAGCTAT pLKO.1 453 CDS 100% 4.950 3.465 N DKK3 n/a
4 TRCN0000033394 GCACCGAGAAATTCACAAGAT pLKO.1 524 CDS 100% 4.950 3.465 N DKK3 n/a
5 TRCN0000033397 GCTGCTAAAGCATCATCAGAA pLKO.1 423 CDS 100% 4.950 3.465 N DKK3 n/a
6 TRCN0000071752 TCTGTGACAACCAGAGGGATT pLKO.1 811 CDS 100% 4.050 2.430 N Dkk3 n/a
7 TRCN0000352104 TCTGTGACAACCAGAGGGATT pLKO_005 811 CDS 100% 4.050 2.430 N Dkk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08057 pDONR223 100% 96% 95.8% None 828_869del;1045A>G n/a
2 ccsbBroad304_08057 pLX_304 0% 96% 95.8% V5 828_869del;1045A>G n/a
3 TRCN0000472220 GCGCGAATCTCTACGAAAAGAAAT pLX_317 26.9% 96% 95.8% V5 828_869del;1045A>G n/a
Download CSV