Construct: ORF TRCN0000472220
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004853.1_s317c1
- Derived from:
- ccsbBroadEn_08057
- DNA Barcode:
- GCGCGAATCTCTACGAAAAGAAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DKK3 (27122)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472220
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 27122 | DKK3 | dickkopf WNT signaling path... | NM_001018057.1 | 99.9% | 99.7% | 1003A>G |
2 | human | 27122 | DKK3 | dickkopf WNT signaling path... | NM_013253.4 | 99.9% | 99.7% | 1003A>G |
3 | human | 27122 | DKK3 | dickkopf WNT signaling path... | NM_015881.5 | 99.9% | 99.7% | 1003A>G |
4 | human | 27122 | DKK3 | dickkopf WNT signaling path... | XM_006718178.2 | 99.9% | 99.7% | 1003A>G |
5 | human | 27122 | DKK3 | dickkopf WNT signaling path... | NM_001330220.2 | 96% | 95.8% | 828_869del;1045A>G |
6 | human | 27122 | DKK3 | dickkopf WNT signaling path... | XM_017017554.2 | 96% | 95.8% | 828_869del;1045A>G |
7 | human | 27122 | DKK3 | dickkopf WNT signaling path... | XM_017017555.1 | 96% | 95.8% | 828_869del;1045A>G |
8 | human | 27122 | DKK3 | dickkopf WNT signaling path... | XM_024448441.1 | 44.6% | 33.8% | (many diffs) |
9 | human | 27122 | DKK3 | dickkopf WNT signaling path... | XM_024448440.1 | 36.5% | 35.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1116
- ORF length:
- 1050
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca gcggcttggg gccaccctgc tgtgcctgct gctggcggcg gcggtcccca 121 cggcccccgc gcccgctccg acggcgacct cggctccagt caagcccggc ccggctctca 181 gctacccgca ggaggaggcc accctcaatg agatgttccg cgaggttgag gaactgatgg 241 aggacacgca gcacaaattg cgcagcgcgg tggaagagat ggaggcagaa gaagctgctg 301 ctaaagcatc atcagaagtg aacctggcaa acttacctcc cagctatcac aatgagacca 361 acacagacac gaaggttgga aataatacca tccatgtgca ccgagaaatt cacaagataa 421 ccaacaacca gactggacaa atggtctttt cagagacagt tatcacatct gtgggagacg 481 aagaaggcag aaggagccac gagtgcatca tcgacgagga ctgtgggccc agcatgtact 541 gccagtttgc cagcttccag tacacctgcc agccatgccg gggccagagg atgctctgca 601 cccgggacag tgagtgctgt ggagaccagc tgtgtgtctg gggtcactgc accaaaatgg 661 ccaccagggg cagcaatggg accatctgtg acaaccagag ggactgccag ccggggctgt 721 gctgtgcctt ccagagaggc ctgctgttcc ctgtgtgcac acccctgccc gtggagggcg 781 agctttgcca tgaccccgcc agccggcttc tggacctcat cacctgggag ctagagccTG 841 ATGGAGCCTT GGACCGATGC CCTTGTGCCA GTGGCCTCCT CTGCCAGCCC CACAGCCACA 901 GCCTGGTGTA TGTGTGCAAG CCGACCTTCG TGGGGAGCCG TGACCAAGAT GGGGAGATCC 961 TGCTGCCCAG AGAGGTCCCC GATGAGTATG AAGTTGGCAG CTTCATGGAG GAGGTGCGCC 1021 AGGAGCTGGA GGACCTGGAG AGGAGCCTGA CTGAAGAGAT GGCGCTGGGG GAGCCTGCGG 1081 CTGCCGCCGC TGCACTGCTG GGAGGGGAAG AGATTTACCC AACTTTCTTG TACAAAGTGG 1141 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1201 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1261 AGCGCGAATC TCTACGAAAA GAAATACGCG TTAAGTCgac aatcaacctc tggattacaa 1321 aatttgtgaa agatt