Transcript: Human NM_001330310.2

Homo sapiens erythrocyte membrane protein band 4.1 like 5 (EPB41L5), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-07-18
Taxon:
Homo sapiens (human)
Gene:
EPB41L5 (57669)
Length:
6553
CDS:
143..2341

Additional Resources:

NCBI RefSeq record:
NM_001330310.2
NBCI Gene record:
EPB41L5 (57669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146871 CCTACATATTAGGCGTTAGTA pLKO.1 6072 3UTR 100% 5.625 7.875 N EPB41L5 n/a
2 TRCN0000148631 CCGACAGATTAAATGCGTGTT pLKO.1 4492 3UTR 100% 4.050 5.670 N EPB41L5 n/a
3 TRCN0000146741 CGATCAGGATTTATTCGACTA pLKO.1 1145 CDS 100% 4.050 5.670 N EPB41L5 n/a
4 TRCN0000146619 CAGGATTTATTCGACTAGGAT pLKO.1 1149 CDS 100% 3.000 4.200 N EPB41L5 n/a
5 TRCN0000130203 CCTACCATGTATGAAGCTATA pLKO.1 3378 3UTR 100% 10.800 8.640 N EPB41L5 n/a
6 TRCN0000247048 TGAGGAGCTAACCCGGTATTT pLKO_005 535 CDS 100% 13.200 9.240 N Epb41l5 n/a
7 TRCN0000130310 GCACTGAATGACGTTAATGTA pLKO.1 1577 CDS 100% 5.625 3.938 N EPB41L5 n/a
8 TRCN0000147412 GCATCTCTAACTGAGAATCTA pLKO.1 2060 CDS 100% 5.625 3.938 N EPB41L5 n/a
9 TRCN0000130970 CCTGAGAAGAACTACGGAGAA pLKO.1 2986 3UTR 100% 4.050 2.835 N EPB41L5 n/a
10 TRCN0000183607 GCTTATAATCTGCAAGCTGAA pLKO.1 632 CDS 100% 4.050 2.835 N Epb41l5 n/a
11 TRCN0000129545 GCCCAGACTTATTGGAAGCAA pLKO.1 1509 CDS 100% 3.000 2.100 N EPB41L5 n/a
12 TRCN0000149034 GCCAAAGGACAAGAGTTGTTT pLKO.1 329 CDS 100% 5.625 3.375 N EPB41L5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330310.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03838 pDONR223 100% 65.6% 60.9% None (many diffs) n/a
2 ccsbBroad304_03838 pLX_304 0% 65.6% 60.9% V5 (many diffs) n/a
Download CSV