Transcript: Human NM_001330350.1

Homo sapiens UbiA prenyltransferase domain containing 1 (UBIAD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
UBIAD1 (29914)
Length:
5563
CDS:
335..874

Additional Resources:

NCBI RefSeq record:
NM_001330350.1
NBCI Gene record:
UBIAD1 (29914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245560 GACACTTGTGGACCGAATCTT pLKO_005 691 CDS 100% 5.625 7.875 N UBIAD1 n/a
2 TRCN0000180590 GATTAACATCCTGTCGGGAGA pLKO.1 364 CDS 100% 2.160 3.024 N UBIAD1 n/a
3 TRCN0000245559 ACTGGAGCACTTGGCTCTTAT pLKO_005 802 CDS 100% 13.200 9.240 N UBIAD1 n/a
4 TRCN0000245562 ATTTGGTCAACACTTACTATG pLKO_005 630 CDS 100% 10.800 7.560 N UBIAD1 n/a
5 TRCN0000245558 TGTCGGGAGAGACTGTCAAAG pLKO_005 375 CDS 100% 10.800 7.560 N UBIAD1 n/a
6 TRCN0000146730 CACTTGGCTCTTATCTACTTT pLKO.1 809 CDS 100% 5.625 3.938 N UBIAD1 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2768 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 4203 3UTR 100% 1.080 0.540 Y GPR83 n/a
9 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 4203 3UTR 100% 1.080 0.540 Y MYORG n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4297 3UTR 100% 13.200 6.600 Y LIAS n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2768 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330350.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03102 pDONR223 100% 52.9% 52% None 529_530ins39;537_538ins438 n/a
2 ccsbBroad304_03102 pLX_304 0% 52.9% 52% V5 529_530ins39;537_538ins438 n/a
Download CSV