Transcript: Human NM_001330419.2

Homo sapiens EI24 autophagy associated transmembrane protein (EI24), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
EI24 (9538)
Length:
2166
CDS:
255..1043

Additional Resources:

NCBI RefSeq record:
NM_001330419.2
NBCI Gene record:
EI24 (9538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427903 GTAATTCTAGCTGTTGTATTT pLKO_005 1534 3UTR 100% 13.200 10.560 N EI24 n/a
2 TRCN0000159966 CGAGTATTTATTCCTGTGCTT pLKO.1 525 CDS 100% 2.640 2.112 N EI24 n/a
3 TRCN0000159876 GCCATTTGGTTTCAGGATATA pLKO.1 681 CDS 100% 13.200 9.240 N EI24 n/a
4 TRCN0000413756 CAAGAGAGTGAGCCACGTATT pLKO_005 435 CDS 100% 10.800 7.560 N EI24 n/a
5 TRCN0000162640 CCCTTGTTTGTGCTTAGCAAA pLKO.1 651 CDS 100% 4.950 3.465 N EI24 n/a
6 TRCN0000162907 GAGATGGCTGACAGTGTCAAA pLKO.1 252 5UTR 100% 4.950 3.465 N EI24 n/a
7 TRCN0000160559 CAAAGCATATCTCTTCCAGTT pLKO.1 994 CDS 100% 4.050 2.835 N EI24 n/a
8 TRCN0000163050 GCTGACATGCTCTTCAACCTT pLKO.1 768 CDS 100% 3.000 2.100 N EI24 n/a
9 TRCN0000127315 CCACGTATTGTTAGTAGAATT pLKO.1 447 CDS 100% 0.000 0.000 N Ei24 n/a
10 TRCN0000312159 CCACGTATTGTTAGTAGAATT pLKO_005 447 CDS 100% 0.000 0.000 N Ei24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02191 pDONR223 100% 77% 66.2% None 671_672ins112;786_787ins122 n/a
2 ccsbBroad304_02191 pLX_304 0% 77% 66.2% V5 671_672ins112;786_787ins122 n/a
Download CSV