Transcript: Human NM_001330451.2

Homo sapiens ETS proto-oncogene 1, transcription factor (ETS1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
ETS1 (2113)
Length:
4977
CDS:
317..1381

Additional Resources:

NCBI RefSeq record:
NM_001330451.2
NBCI Gene record:
ETS1 (2113)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231915 GTGCAGATGTCCCACTATTAA pLKO_005 408 CDS 100% 15.000 21.000 N ETS1 n/a
2 TRCN0000231917 ATCCCGCTATACCTCGGATTA pLKO_005 769 CDS 100% 10.800 15.120 N ETS1 n/a
3 TRCN0000005590 CCGCTATACCTCGGATTACTT pLKO.1 772 CDS 100% 5.625 7.875 N ETS1 n/a
4 TRCN0000005589 CCGGATATGGAATGTGCAGAT pLKO.1 395 CDS 100% 4.050 5.265 N ETS1 n/a
5 TRCN0000231919 CCAAATTCATGGGACTTATAT pLKO_005 2140 3UTR 100% 15.000 10.500 N ETS1 n/a
6 TRCN0000005591 CTGGAATTACTCACTGATAAA pLKO.1 1079 CDS 100% 13.200 9.240 N ETS1 n/a
7 TRCN0000231916 TGTGAAACCATATCAAGTTAA pLKO_005 724 CDS 100% 13.200 9.240 N ETS1 n/a
8 TRCN0000005588 CCCAGAATTATCAGGAACATA pLKO.1 3349 3UTR 100% 5.625 3.938 N ETS1 n/a
9 TRCN0000005592 GCCCTGGGTAAAGACTGCTTT pLKO.1 635 CDS 100% 4.950 2.970 N ETS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10809 pDONR223 100% 74.5% 70.9% None (many diffs) n/a
2 ccsbBroad304_10809 pLX_304 0% 74.5% 70.9% V5 (many diffs) n/a
Download CSV