Transcript: Human NM_001330500.2

Homo sapiens bifunctional apoptosis regulator (BFAR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
BFAR (51283)
Length:
2528
CDS:
142..1119

Additional Resources:

NCBI RefSeq record:
NM_001330500.2
NBCI Gene record:
BFAR (51283)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296484 GGCATAGAGAGTTGCACATAA pLKO_005 1591 3UTR 100% 13.200 10.560 N BFAR n/a
2 TRCN0000296429 TACTCTCAGTTCTGGAATTAT pLKO_005 869 CDS 100% 15.000 10.500 N BFAR n/a
3 TRCN0000033829 GCCCTGTACTTTAACCCAATT pLKO.1 1042 CDS 100% 10.800 7.560 N BFAR n/a
4 TRCN0000308233 GGACTGGTTGGAGGTCCATTA pLKO_005 813 CDS 100% 10.800 7.560 N BFAR n/a
5 TRCN0000033830 CCTCAGATTTCTGTTAGTGAA pLKO.1 214 CDS 100% 4.950 3.465 N BFAR n/a
6 TRCN0000033833 CCTACCTTTCATCCACACCAT pLKO.1 651 CDS 100% 2.640 1.848 N BFAR n/a
7 TRCN0000289982 CCTACCTTTCATCCACACCAT pLKO_005 651 CDS 100% 2.640 1.848 N BFAR n/a
8 TRCN0000033831 CCAGAATCTCTGGGAATATAA pLKO.1 528 CDS 100% 15.000 9.000 N BFAR n/a
9 TRCN0000296486 TGCCGTCACTGCCTTGCTTTA pLKO_005 301 CDS 100% 10.800 6.480 N BFAR n/a
10 TRCN0000140536 GCCAACATGGTGAAACCTCAT pLKO.1 1948 3UTR 100% 4.050 2.025 Y TLCD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330500.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03265 pDONR223 100% 72.2% 72.2% None 261_262ins375 n/a
2 ccsbBroad304_03265 pLX_304 0% 72.2% 72.2% V5 261_262ins375 n/a
3 TRCN0000469673 GTCCCACACCTGTTTACAAGTGCG pLX_317 31.3% 72.2% 72.2% V5 261_262ins375 n/a
Download CSV