Transcript: Human NM_001330575.1

Homo sapiens 2,4-dienoyl-CoA reductase 1 (DECR1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
DECR1 (1666)
Length:
3530
CDS:
809..1789

Additional Resources:

NCBI RefSeq record:
NM_001330575.1
NBCI Gene record:
DECR1 (1666)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046514 CGATGCTACCACCTAATAGTT pLKO.1 930 CDS 100% 5.625 7.875 N DECR1 n/a
2 TRCN0000343117 CGATGCTACCACCTAATAGTT pLKO_005 930 CDS 100% 5.625 7.875 N DECR1 n/a
3 TRCN0000046517 GTAGAAGAACTCGCAAATCTT pLKO.1 1601 CDS 100% 5.625 4.500 N DECR1 n/a
4 TRCN0000343180 GTAGAAGAACTCGCAAATCTT pLKO_005 1601 CDS 100% 5.625 4.500 N DECR1 n/a
5 TRCN0000046513 CCCAACTGGAACATTTGAGAA pLKO.1 1540 CDS 100% 4.950 3.960 N DECR1 n/a
6 TRCN0000343119 CCCAACTGGAACATTTGAGAA pLKO_005 1540 CDS 100% 4.950 3.960 N DECR1 n/a
7 TRCN0000046516 GCCTTGGTAAAGGAATGACAA pLKO.1 990 CDS 100% 4.950 3.465 N DECR1 n/a
8 TRCN0000046515 GCAGAACAAATTTCTTCTCAA pLKO.1 1079 CDS 100% 4.950 2.970 N DECR1 n/a
9 TRCN0000343181 GCAGAACAAATTTCTTCTCAA pLKO_005 1079 CDS 100% 4.950 2.970 N DECR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00433 pDONR223 100% 94.9% 92% None (many diffs) n/a
2 ccsbBroad304_00433 pLX_304 0% 94.9% 92% V5 (many diffs) n/a
3 TRCN0000476713 CTACCTCTGGCCATGAGCAATTTT pLX_317 38.7% 94.9% 92% V5 (many diffs) n/a
Download CSV