Transcript: Mouse NM_001330649.1

Mus musculus C1D nuclear receptor co-repressor (C1d), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
C1d (57316)
Length:
3236
CDS:
330..755

Additional Resources:

NCBI RefSeq record:
NM_001330649.1
NBCI Gene record:
C1d (57316)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001330649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103694 TGCTTCGAGATTTGTCAAGAA pLKO.1 668 CDS 100% 4.950 6.930 N C1d n/a
2 TRCN0000103693 CCCGTAGAAATTCACGAGTCT pLKO.1 360 CDS 100% 2.640 3.696 N C1d n/a
3 TRCN0000103691 GTTTCTGCATACACCTTAAAT pLKO.1 501 CDS 100% 15.000 12.000 N C1d n/a
4 TRCN0000103690 GCTGTCTTGATATTCAAAGTA pLKO.1 1193 3UTR 100% 5.625 4.500 N C1d n/a
5 TRCN0000287308 GCTGTCTTGATATTCAAAGTA pLKO_005 1193 3UTR 100% 5.625 4.500 N C1d n/a
6 TRCN0000294686 TTGGCAACTCAAGGAGTTAAT pLKO_005 540 CDS 100% 13.200 9.240 N C1d n/a
7 TRCN0000294749 GAAGACCATGATGGCTGTTTC pLKO_005 425 CDS 100% 10.800 7.560 N C1d n/a
8 TRCN0000306931 TTGCAGAAGTTGGACCCATTG pLKO_005 459 CDS 100% 6.000 4.200 N C1d n/a
9 TRCN0000294750 CATCCAGTGAAGCAGGAACTG pLKO_005 570 CDS 100% 4.050 2.835 N C1d n/a
10 TRCN0000103692 AGAGTCTACATGAACAGAGTT pLKO.1 600 CDS 100% 4.950 2.970 N C1d n/a
11 TRCN0000153565 GAGTTGTTGCAGAAGTTGGAT pLKO.1 453 CDS 100% 3.000 1.800 N C1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07607 pDONR223 100% 87% 90% None (many diffs) n/a
2 ccsbBroad304_07607 pLX_304 0% 87% 90% V5 (many diffs) n/a
3 TRCN0000473688 AAACTCCCCTATCGTGTACGCCTT pLX_317 100% 87% 90% V5 (many diffs) n/a
4 ccsbBroadEn_02433 pDONR223 100% 86.7% 90% None (many diffs) n/a
5 ccsbBroad304_02433 pLX_304 0% 86.7% 90% V5 (many diffs) n/a
6 TRCN0000478649 ACTTTTCACATGACTCTCCGGTTG pLX_317 94.1% 86.7% 90% V5 (many diffs) n/a
Download CSV