Transcript: Human NM_001331024.1

Homo sapiens kelch like family member 2 (KLHL2), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-12-17
Taxon:
Homo sapiens (human)
Gene:
KLHL2 (11275)
Length:
3015
CDS:
429..1919

Additional Resources:

NCBI RefSeq record:
NM_001331024.1
NBCI Gene record:
KLHL2 (11275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001331024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064965 CGAACAAGTGTGCAGCTTAAT pLKO.1 734 CDS 100% 13.200 18.480 N KLHL2 n/a
2 TRCN0000300128 CGAACAAGTGTGCAGCTTAAT pLKO_005 734 CDS 100% 13.200 18.480 N KLHL2 n/a
3 TRCN0000064966 CGTCAGTGTCTTAGCACAGTA pLKO.1 1515 CDS 100% 4.950 3.960 N KLHL2 n/a
4 TRCN0000300189 CGTCAGTGTCTTAGCACAGTA pLKO_005 1515 CDS 100% 4.950 3.960 N KLHL2 n/a
5 TRCN0000064964 GCTTGCAAAGATTACCTCATT pLKO.1 945 CDS 100% 4.950 3.960 N KLHL2 n/a
6 TRCN0000300187 GCTTGCAAAGATTACCTCATT pLKO_005 945 CDS 100% 4.950 3.960 N KLHL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331024.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07792 pDONR223 100% 83.5% 79.5% None 0_1ins169;85_86ins122;733A>G n/a
2 ccsbBroad304_07792 pLX_304 0% 83.5% 79.5% V5 0_1ins169;85_86ins122;733A>G n/a
3 TRCN0000467596 TTCATGAAGCTCCGCGGTCAGTTA pLX_317 25.2% 83.5% 79.5% V5 0_1ins169;85_86ins122;733A>G n/a
Download CSV