Transcript: Mouse NM_001331067.1

Mus musculus solute carrier family 33 (acetyl-CoA transporter), member 1 (Slc33a1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Slc33a1 (11416)
Length:
2931
CDS:
1178..2005

Additional Resources:

NCBI RefSeq record:
NM_001331067.1
NBCI Gene record:
Slc33a1 (11416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079818 CCTGTCATTGAGTCGTATTTA pLKO.1 2327 3UTR 100% 15.000 21.000 N Slc33a1 n/a
2 TRCN0000325872 CCTGTCATTGAGTCGTATTTA pLKO_005 2327 3UTR 100% 15.000 21.000 N Slc33a1 n/a
3 TRCN0000042921 CTACTCTTTCTTTACGTGCTT pLKO.1 775 5UTR 100% 2.640 3.696 N SLC33A1 n/a
4 TRCN0000306047 GGACCGTTTGCTCGGAAATAT pLKO_005 1029 5UTR 100% 15.000 12.000 N Slc33a1 n/a
5 TRCN0000079822 CCACTCCTCATCAGCAAGTAT pLKO.1 1433 CDS 100% 5.625 3.938 N Slc33a1 n/a
6 TRCN0000079819 GCCGTCTACTTTAAGAACTTT pLKO.1 934 5UTR 100% 5.625 3.938 N Slc33a1 n/a
7 TRCN0000325871 GCCGTCTACTTTAAGAACTTT pLKO_005 934 5UTR 100% 5.625 3.938 N Slc33a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331067.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02104 pDONR223 100% 44.6% 39.4% None (many diffs) n/a
2 ccsbBroad304_02104 pLX_304 0% 44.6% 39.4% V5 (many diffs) n/a
3 TRCN0000474996 TTTTATCCTGCCAGCTCTTGTGTT pLX_317 3.7% 44.6% 39.4% V5 (many diffs) n/a
Download CSV