Transcript: Mouse NM_001331110.1

Mus musculus activated leukocyte cell adhesion molecule (Alcam), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Alcam (11658)
Length:
5024
CDS:
617..2329

Additional Resources:

NCBI RefSeq record:
NM_001331110.1
NBCI Gene record:
Alcam (11658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094210 CCGAACAAGAAATCTTTGATA pLKO.1 1320 CDS 100% 5.625 7.875 N Alcam n/a
2 TRCN0000327424 CCGAACAAGAAATCTTTGATA pLKO_005 1320 CDS 100% 5.625 7.875 N Alcam n/a
3 TRCN0000150706 CAGCCATGATAATAGGTCATA pLKO.1 2543 3UTR 100% 4.950 6.930 N ALCAM n/a
4 TRCN0000323219 CAGCCATGATAATAGGTCATA pLKO_005 2543 3UTR 100% 4.950 6.930 N ALCAM n/a
5 TRCN0000377058 CACCTGTTCTGTGACATATTA pLKO_005 1270 CDS 100% 15.000 10.500 N Alcam n/a
6 TRCN0000094211 CCAGCTATACATTGGACCATT pLKO.1 1943 CDS 100% 4.950 3.465 N Alcam n/a
7 TRCN0000327357 CCAGCTATACATTGGACCATT pLKO_005 1943 CDS 100% 4.950 3.465 N Alcam n/a
8 TRCN0000094209 CGTGGATTGTATTTAAGACAT pLKO.1 2388 3UTR 100% 4.950 3.465 N Alcam n/a
9 TRCN0000363557 CGTGGATTGTATTTAAGACAT pLKO_005 2388 3UTR 100% 4.950 3.465 N Alcam n/a
10 TRCN0000094212 GCTGGGAACTATGTCTGTGAA pLKO.1 1775 CDS 100% 4.950 3.465 N Alcam n/a
11 TRCN0000179701 GCAGCCATGATAATAGGTCAT pLKO.1 2542 3UTR 100% 4.050 2.835 N ALCAM n/a
12 TRCN0000094213 CCTGAGGAGAATGTAACATTA pLKO.1 2045 CDS 100% 13.200 7.920 N Alcam n/a
13 TRCN0000327435 CCTGAGGAGAATGTAACATTA pLKO_005 2045 CDS 100% 13.200 7.920 N Alcam n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331110.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05800 pDONR223 100% 87% 90.7% None (many diffs) n/a
2 ccsbBroad304_05800 pLX_304 0% 87% 90.7% V5 (many diffs) n/a
3 TRCN0000475983 CTCTTTATGTTCTAATTAATGAAG pLX_317 18.6% 87% 90.7% V5 (many diffs) n/a
Download CSV