Transcript: Mouse NM_001331115.1

Mus musculus aldehyde dehydrogenase family 3, subfamily A2 (Aldh3a2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Aldh3a2 (11671)
Length:
3263
CDS:
348..1661

Additional Resources:

NCBI RefSeq record:
NM_001331115.1
NBCI Gene record:
Aldh3a2 (11671)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041369 CGTAACAATAAGCTCATCAAA pLKO.1 1233 CDS 100% 5.625 7.875 N Aldh3a2 n/a
2 TRCN0000308656 CGTAACAATAAGCTCATCAAA pLKO_005 1233 CDS 100% 5.625 7.875 N Aldh3a2 n/a
3 TRCN0000041370 CGTCACTTTAAGAGGTTACAA pLKO.1 993 CDS 100% 5.625 7.875 N Aldh3a2 n/a
4 TRCN0000308657 CGTCACTTTAAGAGGTTACAA pLKO_005 993 CDS 100% 5.625 7.875 N Aldh3a2 n/a
5 TRCN0000041371 GCCATTGTTAAGCCCTCAGAA pLKO.1 531 CDS 100% 4.950 6.930 N Aldh3a2 n/a
6 TRCN0000308654 GCCATTGTTAAGCCCTCAGAA pLKO_005 531 CDS 100% 4.950 6.930 N Aldh3a2 n/a
7 TRCN0000041368 CCACCCAAAGTCTGTGTGTTT pLKO.1 2215 3UTR 100% 4.950 3.465 N Aldh3a2 n/a
8 TRCN0000308655 CCACCCAAAGTCTGTGTGTTT pLKO_005 2215 3UTR 100% 4.950 3.465 N Aldh3a2 n/a
9 TRCN0000041372 CCTGACTATATCCTGTGCGAA pLKO.1 867 CDS 100% 2.640 1.848 N Aldh3a2 n/a
10 TRCN0000308653 CCTGACTATATCCTGTGCGAA pLKO_005 867 CDS 100% 2.640 1.848 N Aldh3a2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.