Transcript: Mouse NM_001331153.1

Mus musculus heat shock factor 1 (Hsf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Hsf1 (15499)
Length:
2368
CDS:
240..1835

Additional Resources:

NCBI RefSeq record:
NM_001331153.1
NBCI Gene record:
Hsf1 (15499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008504 CTGGACCCATAATCTCCGATA pLKO.1 1021 CDS 100% 4.050 5.670 N Hsf1 n/a
2 TRCN0000280459 CTGGACCCATAATCTCCGATA pLKO_005 1021 CDS 100% 4.050 5.670 N Hsf1 n/a
3 TRCN0000008503 CCCTGAAGAGTGAGGACATAA pLKO.1 610 CDS 100% 13.200 9.240 N Hsf1 n/a
4 TRCN0000280518 CCCTGAAGAGTGAGGACATAA pLKO_005 610 CDS 100% 13.200 9.240 N Hsf1 n/a
5 TRCN0000008502 GCTGCATACCTGCTGCCTTTA pLKO.1 2023 3UTR 100% 10.800 7.560 N Hsf1 n/a
6 TRCN0000280517 GCTGCATACCTGCTGCCTTTA pLKO_005 2023 3UTR 100% 10.800 7.560 N Hsf1 n/a
7 TRCN0000280463 GGAACAGCTTCCACGTGTTTG pLKO_005 361 CDS 100% 10.800 7.560 N Hsf1 n/a
8 TRCN0000008505 GCAGCTCAACATGTATGGCTT pLKO.1 452 CDS 100% 2.640 1.848 N Hsf1 n/a
9 TRCN0000007483 GCCCAAGTACTTCAAGCACAA pLKO.1 410 CDS 100% 4.050 2.430 N HSF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331153.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00794 pDONR223 100% 78.9% 81.1% None (many diffs) n/a
2 ccsbBroad304_00794 pLX_304 0% 78.9% 81.1% V5 (many diffs) n/a
3 TRCN0000470291 TGGGTAATAACTGTGAGCGGGGTT pLX_317 29.7% 78.9% 81.1% V5 (many diffs) n/a
Download CSV