Transcript: Mouse NM_001331226.1

Mus musculus leucine-zipper-like transcriptional regulator, 1 (Lztr1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Lztr1 (66863)
Length:
3098
CDS:
290..2542

Additional Resources:

NCBI RefSeq record:
NM_001331226.1
NBCI Gene record:
Lztr1 (66863)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001331226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103741 CCGGGATAAGATGTTCGTGTT pLKO.1 727 CDS 100% 4.050 5.670 N Lztr1 n/a
2 TRCN0000287309 CCGGGATAAGATGTTCGTGTT pLKO_005 727 CDS 100% 4.050 5.670 N Lztr1 n/a
3 TRCN0000103742 CCCGTACTATTACGGCTTCTA pLKO.1 2254 CDS 100% 0.495 0.693 N Lztr1 n/a
4 TRCN0000287311 CCCGTACTATTACGGCTTCTA pLKO_005 2254 CDS 100% 0.495 0.693 N Lztr1 n/a
5 TRCN0000294756 GTGCACACTGCACGAAGATTA pLKO_005 1297 CDS 100% 13.200 9.240 N Lztr1 n/a
6 TRCN0000103744 CCCAATGAGTTGCACTGCTAT pLKO.1 941 CDS 100% 4.950 3.465 N Lztr1 n/a
7 TRCN0000287240 CCCAATGAGTTGCACTGCTAT pLKO_005 941 CDS 100% 4.950 3.465 N Lztr1 n/a
8 TRCN0000103740 GCCTCCAGATAGGTACAGATA pLKO.1 2923 3UTR 100% 4.950 3.465 N Lztr1 n/a
9 TRCN0000287310 GCCTCCAGATAGGTACAGATA pLKO_005 2923 3UTR 100% 4.950 3.465 N Lztr1 n/a
10 TRCN0000103743 CGTGGCATATAAGGATGCCAT pLKO.1 238 5UTR 100% 0.264 0.185 N Lztr1 n/a
11 TRCN0000240478 TCTATGGGAGCAGCATGTTTG pLKO_005 393 CDS 100% 10.800 7.560 N LZTR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001331226.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11260 pDONR223 100% 63.6% 69.3% None (many diffs) n/a
2 ccsbBroad304_11260 pLX_304 0% 63.6% 69.3% V5 (many diffs) n/a
3 TRCN0000466736 TGGAATTAGCTCCACCGTGTACTT pLX_317 22.3% 63.6% 69.3% V5 (many diffs) n/a
Download CSV