Transcript: Human NM_001340.5

Homo sapiens cylicin 2 (CYLC2), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
CYLC2 (1539)
Length:
2149
CDS:
49..1095

Additional Resources:

NCBI RefSeq record:
NM_001340.5
NBCI Gene record:
CYLC2 (1539)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001340.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141509 CGGGACAACACGGTTTCTATA pLKO.1 211 CDS 100% 13.200 9.240 N CYLC2 n/a
2 TRCN0000144549 GAGATCGTAGACAACCATTAT pLKO.1 254 CDS 100% 13.200 9.240 N CYLC2 n/a
3 TRCN0000121756 CCAGTCAGTGAATTAAGCAAA pLKO.1 103 CDS 100% 4.950 3.465 N CYLC2 n/a
4 TRCN0000141372 CGTGAGGATGGATTGGACATT pLKO.1 1992 3UTR 100% 4.950 3.465 N CYLC2 n/a
5 TRCN0000145564 GAAAGGCAAGGATATAGAGAA pLKO.1 474 CDS 100% 4.950 3.465 N CYLC2 n/a
6 TRCN0000121610 GCCTACATCTTTCTTTCTGAA pLKO.1 1706 3UTR 100% 4.950 3.465 N CYLC2 n/a
7 TRCN0000143691 GTAGTACAGACAGTGACTCAA pLKO.1 881 CDS 100% 4.950 3.465 N CYLC2 n/a
8 TRCN0000143163 GAATCGAAGGATGCCAAGAAA pLKO.1 814 CDS 100% 5.625 3.375 N CYLC2 n/a
9 TRCN0000145246 GCCAAGAAAGATACTGAGAAA pLKO.1 958 CDS 100% 4.950 2.970 N CYLC2 n/a
10 TRCN0000142640 GCTGGAGTTCAGTGACATGAT pLKO.1 1814 3UTR 100% 4.950 2.970 N CYLC2 n/a
11 TRCN0000143164 GCTGATTCAAAGAAGGATGCA pLKO.1 985 CDS 100% 2.640 1.584 N CYLC2 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1436 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1861 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001340.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00405 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00405 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492275 ATGACTTTTTTCAACCCAACAAAC pLX_317 38.3% 96.2% 95.9% V5 1002T>G;1004_1005delCAinsGC;1009_1044del n/a
Download CSV