Transcript: Human NM_001345978.1

Homo sapiens peptidyl-tRNA hydrolase 1 homolog (PTRH1), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-15
Taxon:
Homo sapiens (human)
Gene:
PTRH1 (138428)
Length:
1073
CDS:
38..586

Additional Resources:

NCBI RefSeq record:
NM_001345978.1
NBCI Gene record:
PTRH1 (138428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001345978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051617 AGAGCCATGAGCCGATGTGTT pLKO.1 80 CDS 100% 4.950 3.465 N PTRH1 n/a
2 TRCN0000234582 AGTAGAGCCATGAGCCGATGT pLKO_005 77 CDS 100% 4.050 2.835 N PTRH1 n/a
3 TRCN0000051615 CGACCTGATCTTGGACCACAT pLKO.1 579 CDS 100% 4.050 2.835 N PTRH1 n/a
4 TRCN0000234586 CGACCTGATCTTGGACCACAT pLKO_005 579 CDS 100% 4.050 2.835 N PTRH1 n/a
5 TRCN0000051616 GAGGAAGTCTACCTGGTGCAT pLKO.1 377 CDS 100% 2.640 1.848 N PTRH1 n/a
6 TRCN0000051613 CCTGCCTGACTGTAGTGCCCA pLKO.1 655 3UTR 100% 0.000 0.000 N PTRH1 n/a
7 TRCN0000234583 AGTCTACCTGGTGCATGATGA pLKO_005 382 CDS 100% 4.950 2.970 N PTRH1 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 1027 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 1024 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001345978.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04919 pDONR223 100% 85% 68.7% None 416_417ins46;546_547ins50 n/a
2 ccsbBroad304_04919 pLX_304 0% 85% 68.7% V5 416_417ins46;546_547ins50 n/a
3 TRCN0000468379 CATTGACATGCTACCCCTCCCAGC pLX_317 69% 85% 68.7% V5 416_417ins46;546_547ins50 n/a
Download CSV