Transcript: Mouse NM_001346118.1

Mus musculus ral guanine nucleotide dissociation stimulator,-like 1 (Rgl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Mus musculus (mouse)
Gene:
Rgl1 (19731)
Length:
5090
CDS:
432..2843

Additional Resources:

NCBI RefSeq record:
NM_001346118.1
NBCI Gene record:
Rgl1 (19731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305387 ATTGGTGAAAGCGACAGATAT pLKO_005 2931 3UTR 100% 13.200 18.480 N Rgl1 n/a
2 TRCN0000305389 ACGTGCAACAACAATCCTAAA pLKO_005 2382 CDS 100% 10.800 15.120 N Rgl1 n/a
3 TRCN0000305390 TCGAGAAGTGGATCAACATTG pLKO_005 1462 CDS 100% 10.800 15.120 N Rgl1 n/a
4 TRCN0000048064 CCACCATCTCTCAGTTTAATA pLKO.1 1369 CDS 100% 15.000 12.000 N RGL1 n/a
5 TRCN0000310593 CCACCATCTCTCAGTTTAATA pLKO_005 1369 CDS 100% 15.000 12.000 N RGL1 n/a
6 TRCN0000110171 CGCCATGAATAGCCAAGTGAA pLKO.1 2690 CDS 100% 4.950 3.960 N Rgl1 n/a
7 TRCN0000110173 CGGGAGCTACTAATGAAGGAA pLKO.1 1659 CDS 100% 3.000 2.400 N Rgl1 n/a
8 TRCN0000309402 CGGGAGCTACTAATGAAGGAA pLKO_005 1659 CDS 100% 3.000 2.400 N Rgl1 n/a
9 TRCN0000305388 ATTTGGTCTCAGCGGGATAAA pLKO_005 1314 CDS 100% 13.200 9.240 N Rgl1 n/a
10 TRCN0000110172 CGAATGTAGAATCCTGAAGAA pLKO.1 1487 CDS 100% 4.950 3.465 N Rgl1 n/a
11 TRCN0000110174 CCAGAAGTTTATCCAGTGGTT pLKO.1 1955 CDS 100% 2.640 1.848 N Rgl1 n/a
12 TRCN0000110170 CGTGTGTGTATGCGTGTGTTT pLKO.1 3100 3UTR 100% 4.950 2.475 Y Rgl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346118.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02728 pDONR223 100% 89.8% 94.2% None (many diffs) n/a
2 ccsbBroad304_02728 pLX_304 0% 89.8% 94.2% V5 (many diffs) n/a
3 TRCN0000477017 GGCACACCGTGGTACATCTTCAGG pLX_317 16.4% 89.8% 94.2% V5 (many diffs) n/a
Download CSV