Transcript: Human NM_001346146.2

Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
FLRT2 (23768)
Length:
33426
CDS:
513..2495

Additional Resources:

NCBI RefSeq record:
NM_001346146.2
NBCI Gene record:
FLRT2 (23768)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439520 CACGAGCTTGGAGCGTCTTAT pLKO_005 1121 CDS 100% 13.200 10.560 N FLRT2 n/a
2 TRCN0000062638 CGTCAGGGAATTAAATATGAA pLKO.1 1559 CDS 100% 5.625 4.500 N FLRT2 n/a
3 TRCN0000062640 CCTCCACAACAACCAAATTAA pLKO.1 719 CDS 100% 15.000 10.500 N FLRT2 n/a
4 TRCN0000427593 CATCTGATCAGGCTCTATTTG pLKO_005 1269 CDS 100% 13.200 9.240 N FLRT2 n/a
5 TRCN0000416819 GCGTTATCAAGGCGGACAATT pLKO_005 2510 3UTR 100% 13.200 9.240 N FLRT2 n/a
6 TRCN0000062639 CGGTAGAAGACACCATTTGTT pLKO.1 2020 CDS 100% 5.625 3.938 N FLRT2 n/a
7 TRCN0000062641 GTCTCCTTAAATAACGATCAA pLKO.1 2340 CDS 100% 4.950 3.465 N FLRT2 n/a
8 TRCN0000062642 CCACATTCCTTTGACAGCCTT pLKO.1 1307 CDS 100% 2.640 1.584 N FLRT2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6579 3UTR 100% 4.950 2.475 Y KAAG1 n/a
10 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 11283 3UTR 100% 4.950 2.475 Y ORAI2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 15661 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 11373 3UTR 100% 10.800 5.400 Y SMIM11A n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9707 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 11280 3UTR 100% 4.950 2.475 Y LOC339059 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9707 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.