Transcript: Human NM_001346173.1

Homo sapiens leucine rich repeat and fibronectin type III domain containing 5 (LRFN5), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
LRFN5 (145581)
Length:
4276
CDS:
1728..3887

Additional Resources:

NCBI RefSeq record:
NM_001346173.1
NBCI Gene record:
LRFN5 (145581)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424763 TTACTACGGAACAGGATTATG pLKO_005 3250 CDS 100% 13.200 18.480 N LRFN5 n/a
2 TRCN0000152260 CGGAACACTTGACATTCTTAT pLKO.1 2744 CDS 100% 13.200 9.240 N LRFN5 n/a
3 TRCN0000421553 GGTATAAGGTTTGCAACAATA pLKO_005 3379 CDS 100% 13.200 9.240 N LRFN5 n/a
4 TRCN0000435089 TTCGCTGACCTACGAAATTTG pLKO_005 2010 CDS 100% 13.200 9.240 N LRFN5 n/a
5 TRCN0000157819 CTTCTCCTCTCTCTCCTGAAA pLKO.1 3897 3UTR 100% 4.950 3.465 N LRFN5 n/a
6 TRCN0000156572 GCCAAGGTGAAAGTCTCTGAT pLKO.1 4018 3UTR 100% 4.950 3.465 N LRFN5 n/a
7 TRCN0000155263 GCTGACTAATGTTGACCAGAT pLKO.1 3833 CDS 100% 4.050 2.835 N LRFN5 n/a
8 TRCN0000155448 GAAATTGTCTACAGGAGCCAA pLKO.1 4002 3UTR 100% 2.640 1.584 N LRFN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489935 GCTCGGGTGGTGGACCCCCTTGGT pLX_317 24.1% 99.9% 100% V5 (not translated due to prior stop codon) 1284A>G;1566T>C n/a
Download CSV