Transcript: Human NM_001346223.2

Homo sapiens interleukin 2 receptor subunit beta (IL2RB), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IL2RB (3560)
Length:
4041
CDS:
133..1788

Additional Resources:

NCBI RefSeq record:
NM_001346223.2
NBCI Gene record:
IL2RB (3560)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000058753 CCAGTTCACATGCTTCTACAA pLKO.1 228 CDS 100% 4.950 6.930 N IL2RB n/a
2 TRCN0000438405 AGTCCCAGACCTGGTGGATTT pLKO_005 1566 CDS 100% 10.800 7.560 N IL2RB n/a
3 TRCN0000421480 GACCCACAGATGCAACATAAG pLKO_005 564 CDS 100% 10.800 7.560 N IL2RB n/a
4 TRCN0000058757 CCAGACACCCAGTATGAGTTT pLKO.1 730 CDS 100% 4.950 3.465 N IL2RB n/a
5 TRCN0000058754 CTTCATCATCTTAGTGTACTT pLKO.1 900 CDS 100% 4.950 3.465 N IL2RB n/a
6 TRCN0000058756 GCCTACTTGTCCCTCCAAGAA pLKO.1 1735 CDS 100% 4.950 3.465 N IL2RB n/a
7 TRCN0000058755 CCAGGGTTACTTCTTCTTCCA pLKO.1 1215 CDS 100% 2.640 1.584 N IL2RB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06438 pDONR223 100% 99.9% 100% None 750C>T n/a
2 ccsbBroad304_06438 pLX_304 0% 99.9% 100% V5 750C>T n/a
3 TRCN0000470349 AATTTAGACTTGGATATCTTCCGG pLX_317 26% 99.9% 100% V5 750C>T n/a
Download CSV