Transcript: Human NM_001346226.2

Homo sapiens WD repeat domain 48 (WDR48), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WDR48 (57599)
Length:
3961
CDS:
178..2040

Additional Resources:

NCBI RefSeq record:
NM_001346226.2
NBCI Gene record:
WDR48 (57599)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151626 GTGCAGGTTTCCTATGTTATT pLKO.1 53 5UTR 100% 13.200 10.560 N WDR48 n/a
2 TRCN0000150552 GCAGAGATGTATAGCAACATA pLKO.1 729 CDS 100% 5.625 3.938 N WDR48 n/a
3 TRCN0000151698 CCTCAAATAACACTGTCACAA pLKO.1 467 CDS 100% 4.950 3.465 N WDR48 n/a
4 TRCN0000151552 GCAGACTATGTCTTTCAAGAT pLKO.1 2275 3UTR 100% 4.950 3.465 N WDR48 n/a
5 TRCN0000154887 CCTTTCTACCTCCAACCTCAT pLKO.1 1702 CDS 100% 4.050 2.835 N WDR48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346226.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12373 pDONR223 100% 80.9% 80.9% None 1_354del n/a
2 ccsbBroad304_12373 pLX_304 0% 80.9% 80.9% V5 1_354del n/a
3 TRCN0000477456 CATGAATGCACAGCCTCTCATTGC pLX_317 21.1% 80.9% 80.9% V5 1_354del n/a
Download CSV