Transcript: Human NM_001346248.2

Homo sapiens Ral GTPase activating protein catalytic alpha subunit 1 (RALGAPA1), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
RALGAPA1 (253959)
Length:
9309
CDS:
461..7948

Additional Resources:

NCBI RefSeq record:
NM_001346248.2
NBCI Gene record:
RALGAPA1 (253959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272312 CTCTACAGTAGAGGTAATATT pLKO_005 7456 CDS 100% 15.000 9.000 N RALGAPA1 n/a
2 TRCN0000272367 TTAGCACGAACATAGGGTTAA pLKO_005 8162 3UTR 100% 10.800 6.480 N RALGAPA1 n/a
3 TRCN0000047350 GCAGTTTCATAGTATTGGATT pLKO.1 769 CDS 100% 4.950 2.970 N RALGAPA1 n/a
4 TRCN0000272309 GGTTAGAGCAACAGCTATAAA pLKO_005 7750 CDS 100% 15.000 7.500 Y RALGAPA1 n/a
5 TRCN0000272310 TGGATTGACCACTCCATATTT pLKO_005 7429 CDS 100% 15.000 7.500 Y RALGAPA1 n/a
6 TRCN0000272366 ACGGGAGCAGAAAGCGATAAA pLKO_005 6077 CDS 100% 13.200 6.600 Y RALGAPA1 n/a
7 TRCN0000047349 GCCTCCTCTTAATAGTGATAT pLKO.1 4300 CDS 100% 13.200 6.600 Y RALGAPA1 n/a
8 TRCN0000047348 CCAGAGATTCTACCCAGTGAA pLKO.1 7983 3UTR 100% 4.950 2.475 Y RALGAPA1 n/a
9 TRCN0000047352 CCTGGATCAAAGCAAACCTAA pLKO.1 2340 CDS 100% 4.950 2.475 Y RALGAPA1 n/a
10 TRCN0000047351 GCTTAGAAGATATAACCGTAA pLKO.1 6777 CDS 100% 4.050 2.025 Y RALGAPA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346248.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.