Transcript: Mouse NM_001346512.1

Mus musculus poly (ADP-ribose) polymerase family, member 11 (Parp11), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Parp11 (101187)
Length:
3478
CDS:
199..945

Additional Resources:

NCBI RefSeq record:
NM_001346512.1
NBCI Gene record:
Parp11 (101187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241941 ATGGATCGGAACCGAATTAAA pLKO_005 409 CDS 100% 15.000 21.000 N Parp11 n/a
2 TRCN0000241942 TGGGAAACAGCGCCTAATAAA pLKO_005 222 CDS 100% 15.000 21.000 N Parp11 n/a
3 TRCN0000241943 CGTAGAAGTCACTCGTGTTAA pLKO_005 3068 3UTR 100% 13.200 18.480 N Parp11 n/a
4 TRCN0000216010 CATCTGTTCAGAACCTATAAA pLKO.1 733 CDS 100% 15.000 10.500 N Parp11 n/a
5 TRCN0000241940 CATCTGTTCAGAACCTATAAA pLKO_005 733 CDS 100% 15.000 10.500 N Parp11 n/a
6 TRCN0000191098 CCATTCATTCAGCTTTGTAAA pLKO.1 2289 3UTR 100% 13.200 9.240 N Parp11 n/a
7 TRCN0000004535 GACGGGAGCTATGTGAATTTA pLKO.1 829 CDS 100% 15.000 21.000 N PARP11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346512.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12328 pDONR223 100% 65.8% 72.2% None (many diffs) n/a
2 ccsbBroad304_12328 pLX_304 0% 65.8% 72.2% V5 (many diffs) n/a
3 TRCN0000474635 CCTCCCTCAACGAGCTCCTTGCTG pLX_317 53.1% 65.8% 72.2% V5 (many diffs) n/a
4 ccsbBroadEn_12329 pDONR223 100% 37.6% 40.4% None (many diffs) n/a
5 ccsbBroad304_12329 pLX_304 0% 37.6% 40.4% V5 (many diffs) n/a
6 TRCN0000468259 CCGAAACAACATAGTAGAGACCCA pLX_317 60% 37.6% 40.4% V5 (many diffs) n/a
Download CSV