Transcript: Human NM_001346541.2

Homo sapiens melanocortin 2 receptor accessory protein 2 (MRAP2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
MRAP2 (112609)
Length:
2037
CDS:
278..637

Additional Resources:

NCBI RefSeq record:
NM_001346541.2
NBCI Gene record:
MRAP2 (112609)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251305 GAAGGACTGAAGGCTCATAAA pLKO_005 225 5UTR 100% 13.200 9.240 N Mrap2 n/a
2 TRCN0000129634 CTGATTTCTGAACCACCTATT pLKO.1 566 CDS 100% 10.800 7.560 N MRAP2 n/a
3 TRCN0000129276 CCAGAATGTCAGGAGACTCAT pLKO.1 1458 3UTR 100% 4.950 3.465 N MRAP2 n/a
4 TRCN0000129231 CCTCAGAGAAGAGATTCAGAA pLKO.1 258 5UTR 100% 4.950 3.465 N MRAP2 n/a
5 TRCN0000130169 CTTTGTGAACACAGACCAGAA pLKO.1 523 CDS 100% 4.050 2.835 N MRAP2 n/a
6 TRCN0000130555 GCTTTGTGTCAGACTTTGGAA pLKO.1 285 CDS 100% 3.000 2.100 N MRAP2 n/a
7 TRCN0000128194 CTGGAGCCAGATAAAGTATTT pLKO.1 311 CDS 100% 13.200 7.920 N MRAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04629 pDONR223 100% 58% 58% None 0_1ins258 n/a
2 ccsbBroad304_04629 pLX_304 0% 58% 58% V5 0_1ins258 n/a
3 TRCN0000468654 ACCCTGAACCAGGATCTACTAACG pLX_317 60.7% 58% 58% V5 0_1ins258 n/a
Download CSV