Transcript: Mouse NM_001346703.1

Mus musculus HPS1, biogenesis of lysosomal organelles complex 3 subunit 1 (Hps1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Hps1 (192236)
Length:
2952
CDS:
378..2516

Additional Resources:

NCBI RefSeq record:
NM_001346703.1
NBCI Gene record:
Hps1 (192236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001346703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000192821 GCCAGAAGATGGACAAGTTTA pLKO.1 1699 CDS 100% 13.200 9.240 N Hps1 n/a
2 TRCN0000298011 GCCAGAAGATGGACAAGTTTA pLKO_005 1699 CDS 100% 13.200 9.240 N Hps1 n/a
3 TRCN0000292557 TTGGTGAAGAGCCGGAGAAAT pLKO_005 1977 CDS 100% 13.200 9.240 N Hps1 n/a
4 TRCN0000379465 ACTTCCTGTGGTTCGAGAATG pLKO_005 2245 CDS 100% 10.800 7.560 N HPS1 n/a
5 TRCN0000082870 CCTGTGGTTCGAGAATGACAT pLKO.1 2249 CDS 100% 4.950 3.465 N HPS1 n/a
6 TRCN0000201507 CCTGTGGTTCGAGAATGACAT pLKO.1 2249 CDS 100% 4.950 3.465 N Hps1 n/a
7 TRCN0000190736 GCAAGCTGTTGGCTTTCTACT pLKO.1 1021 CDS 100% 4.950 3.465 N Hps1 n/a
8 TRCN0000292556 GCAAGCTGTTGGCTTTCTACT pLKO_005 1021 CDS 100% 4.950 3.465 N Hps1 n/a
9 TRCN0000082869 GTCCTCTTCTACTGGACAGAT pLKO.1 414 CDS 100% 4.950 3.465 N HPS1 n/a
10 TRCN0000190430 CCTTTGTCAAAGCCAAGGTCT pLKO.1 2140 CDS 100% 2.640 1.848 N Hps1 n/a
11 TRCN0000190580 GCAGAAGAACGTCTTAGTGCT pLKO.1 2702 3UTR 100% 2.640 1.848 N Hps1 n/a
12 TRCN0000292554 GCAGAAGAACGTCTTAGTGCT pLKO_005 2702 3UTR 100% 2.640 1.848 N Hps1 n/a
13 TRCN0000190490 GCATCTGTTTGGAGAGTACCT pLKO.1 626 CDS 100% 2.640 1.848 N Hps1 n/a
14 TRCN0000292555 GCATCTGTTTGGAGAGTACCT pLKO_005 626 CDS 100% 2.640 1.848 N Hps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.