Transcript: Human NM_001347006.1

Homo sapiens transmembrane protein 62 (TMEM62), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TMEM62 (80021)
Length:
2801
CDS:
702..2243

Additional Resources:

NCBI RefSeq record:
NM_001347006.1
NBCI Gene record:
TMEM62 (80021)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244151 GTACTCCCTTTGGCAACTATT pLKO_005 835 CDS 100% 13.200 18.480 N TMEM62 n/a
2 TRCN0000244152 GGCCTAAGAGACCCTATAATT pLKO_005 889 CDS 100% 15.000 10.500 N TMEM62 n/a
3 TRCN0000244153 TATGCCTGTTCACCTACTTAT pLKO_005 2027 CDS 100% 13.200 9.240 N TMEM62 n/a
4 TRCN0000244155 TCACCAGGAATCCGGTCAATA pLKO_005 1029 CDS 100% 13.200 9.240 N TMEM62 n/a
5 TRCN0000244154 GCAGCTGTCAAAGGTGCAATT pLKO_005 2623 3UTR 100% 10.800 7.560 N TMEM62 n/a
6 TRCN0000172838 GACACTGAACTCCACCAAGTT pLKO.1 2180 CDS 100% 4.950 3.465 N TMEM62 n/a
7 TRCN0000172808 GCCTGTGGTTCTTATCACCAA pLKO.1 1241 CDS 100% 2.640 1.584 N TMEM62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12662 pDONR223 100% 84.7% 84.7% None 1_234del n/a
2 ccsbBroad304_12662 pLX_304 0% 84.7% 84.7% V5 1_234del n/a
3 TRCN0000469273 ATCGAAAAACCCCCCCGTTCATTC pLX_317 28.6% 84.7% 84.7% V5 1_234del n/a
Download CSV