Transcript: Human NM_001347034.1

Homo sapiens transmembrane protein 62 (TMEM62), transcript variant 31, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
TMEM62 (80021)
Length:
2410
CDS:
650..1852

Additional Resources:

NCBI RefSeq record:
NM_001347034.1
NBCI Gene record:
TMEM62 (80021)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244153 TATGCCTGTTCACCTACTTAT pLKO_005 1636 CDS 100% 13.200 9.240 N TMEM62 n/a
2 TRCN0000244155 TCACCAGGAATCCGGTCAATA pLKO_005 743 CDS 100% 13.200 9.240 N TMEM62 n/a
3 TRCN0000244154 GCAGCTGTCAAAGGTGCAATT pLKO_005 2232 3UTR 100% 10.800 7.560 N TMEM62 n/a
4 TRCN0000172838 GACACTGAACTCCACCAAGTT pLKO.1 1789 CDS 100% 4.950 3.465 N TMEM62 n/a
5 TRCN0000172808 GCCTGTGGTTCTTATCACCAA pLKO.1 955 CDS 100% 2.640 1.584 N TMEM62 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347034.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12662 pDONR223 100% 91.9% 91.9% None 756_757ins105 n/a
2 ccsbBroad304_12662 pLX_304 0% 91.9% 91.9% V5 756_757ins105 n/a
3 TRCN0000469273 ATCGAAAAACCCCCCCGTTCATTC pLX_317 28.6% 91.9% 91.9% V5 756_757ins105 n/a
Download CSV