Transcript: Mouse NM_001347064.1

Mus musculus H2A histone family, member V (H2afv), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
H2afv (77605)
Length:
1531
CDS:
105..377

Additional Resources:

NCBI RefSeq record:
NM_001347064.1
NBCI Gene record:
H2afv (77605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093030 GTTAGCAGGTAATGCTTCCAA pLKO.1 194 CDS 100% 3.000 4.200 N H2afv n/a
2 TRCN0000093031 AGATCTCAAAGTGAAGCGCAT pLKO.1 215 CDS 100% 2.160 1.728 N H2afv n/a
3 TRCN0000093028 GTGTTGGAGTTAGCAGGTAAT pLKO.1 186 CDS 100% 10.800 7.560 N H2afv n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04620 pDONR223 100% 63.8% 70.3% None (many diffs) n/a
2 ccsbBroad304_04620 pLX_304 0% 63.8% 70.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000470909 TCCATAAACAGCCGTATAATACCA pLX_317 70.4% 63.8% 70.3% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV