Transcript: Mouse NM_001347082.1

Mus musculus polymerase (DNA-directed), delta interacting protein 3 (Poldip3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Poldip3 (73826)
Length:
3214
CDS:
126..1301

Additional Resources:

NCBI RefSeq record:
NM_001347082.1
NBCI Gene record:
Poldip3 (73826)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102527 CGGTTTCGGATCAAAGGGAAA pLKO.1 375 CDS 100% 4.050 5.670 N Poldip3 n/a
2 TRCN0000324698 CGGTTTCGGATCAAAGGGAAA pLKO_005 375 CDS 100% 4.050 5.670 N Poldip3 n/a
3 TRCN0000102525 CCCACCTTTCTGTGTTGTTTA pLKO.1 1443 3UTR 100% 13.200 9.240 N Poldip3 n/a
4 TRCN0000324700 CCCACCTTTCTGTGTTGTTTA pLKO_005 1443 3UTR 100% 13.200 9.240 N Poldip3 n/a
5 TRCN0000102528 CAACCTATGAAGTGCAACCTT pLKO.1 1062 CDS 100% 3.000 2.100 N Poldip3 n/a
6 TRCN0000102529 TGGGCAACCTATGAAGTGCAA pLKO.1 1058 CDS 100% 2.640 1.848 N Poldip3 n/a
7 TRCN0000324637 TGGGCAACCTATGAAGTGCAA pLKO_005 1058 CDS 100% 2.640 1.848 N Poldip3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12800 pDONR223 100% 50.3% 51.2% None (many diffs) n/a
2 ccsbBroad304_12800 pLX_304 0% 50.3% 51.2% V5 (many diffs) n/a
3 TRCN0000491529 ACTGGCAGGTAGTGCTAAAGGATT pLX_317 62.5% 50.3% 51.2% V5 (many diffs) n/a
Download CSV