Transcript: Mouse NM_001347201.1

Mus musculus guanylyl cyclase domain containing 1 (Gucd1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gucd1 (68778)
Length:
2870
CDS:
188..790

Additional Resources:

NCBI RefSeq record:
NM_001347201.1
NBCI Gene record:
Gucd1 (68778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001347201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000283844 TACCGGCTGCATCTTCTATAA pLKO_005 658 CDS 100% 0.000 0.000 N Gucd1 n/a
2 TRCN0000283849 CATCGTCCTGCGTGGCTATAA pLKO_005 631 CDS 100% 13.200 10.560 N Gucd1 n/a
3 TRCN0000268910 CAAGTCCAGTCACCCATATTA pLKO_005 2097 3UTR 100% 15.000 10.500 N Gucd1 n/a
4 TRCN0000283847 CTATCATCCAGCAGCTATATC pLKO_005 138 5UTR 100% 13.200 9.240 N Gucd1 n/a
5 TRCN0000268959 TGCAGCACCAGCATCAGTAAC pLKO_005 704 CDS 100% 10.800 7.560 N Gucd1 n/a
6 TRCN0000130769 GTAACTTTGAGGAGGCCAGAA pLKO.1 720 CDS 100% 4.050 2.835 N GUCD1 n/a
7 TRCN0000130491 GAAATGCACAGTGAGTGTGAA pLKO.1 451 CDS 100% 4.950 3.465 N GUCD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12747 pDONR223 100% 76.7% 80.3% None (many diffs) n/a
2 ccsbBroad304_12747 pLX_304 0% 76.7% 80.3% V5 (many diffs) n/a
3 TRCN0000469738 AACCATTTTGTACGTGACACCTAA pLX_317 49.5% 76.7% 80.3% V5 (many diffs) n/a
Download CSV