Transcript: Human NM_001347219.2

Homo sapiens WD repeat domain 13 (WDR13), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
WDR13 (64743)
Length:
5423
CDS:
405..1586

Additional Resources:

NCBI RefSeq record:
NM_001347219.2
NBCI Gene record:
WDR13 (64743)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001347219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000323141 AGATGAACCGTGCCGTCTATG pLKO_005 493 CDS 100% 10.800 15.120 N WDR13 n/a
2 TRCN0000180619 GATCCCTCACTGCTCATCAAT pLKO.1 1233 CDS 100% 5.625 7.875 N WDR13 n/a
3 TRCN0000129454 GTCCTTGCTCTGTCCTTTGAT pLKO.1 1047 CDS 100% 5.625 3.938 N WDR13 n/a
4 TRCN0000323138 GTCCTTGCTCTGTCCTTTGAT pLKO_005 1047 CDS 100% 5.625 3.938 N WDR13 n/a
5 TRCN0000129516 GAACATCTCCACAGGCAAGAA pLKO.1 992 CDS 100% 4.950 3.465 N WDR13 n/a
6 TRCN0000124363 CATGAACATCTCCACAGGCAA pLKO.1 989 CDS 100% 2.640 1.848 N Wdr13 n/a
7 TRCN0000349525 CATGAACATCTCCACAGGCAA pLKO_005 989 CDS 100% 2.640 1.848 N Wdr13 n/a
8 TRCN0000130974 CGTGCACTTCTTTGATGTGGA pLKO.1 1424 CDS 100% 2.640 1.848 N WDR13 n/a
9 TRCN0000323140 CGTGCACTTCTTTGATGTGGA pLKO_005 1424 CDS 100% 2.640 1.848 N WDR13 n/a
10 TRCN0000147962 GTCTTCTCTTTCCTCTTTGAT pLKO.1 1110 CDS 100% 5.625 3.375 N WDR13 n/a
11 TRCN0000323139 GTCTTCTCTTTCCTCTTTGAT pLKO_005 1110 CDS 100% 5.625 3.375 N WDR13 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4142 3UTR 100% 4.950 2.475 Y LOC387873 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2375 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4414 3UTR 100% 4.950 2.475 Y C16orf89 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2242 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2375 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001347219.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.